Incidental Mutation 'R8712:Sall3'
ID669685
Institutional Source Beutler Lab
Gene Symbol Sall3
Ensembl Gene ENSMUSG00000024565
Gene Namespalt like transcription factor 3
SynonymsMsal, Spalt, Msal-1, Salt, B130022O04Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8712 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location80966376-80986578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80974021 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 231 (I231V)
Ref Sequence ENSEMBL: ENSMUSP00000056967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057950]
Predicted Effect probably benign
Transcript: ENSMUST00000057950
AA Change: I231V

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: I231V

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 210 231 N/A INTRINSIC
low complexity region 271 289 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 350 371 N/A INTRINSIC
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 3.21e-4 SMART
low complexity region 555 568 N/A INTRINSIC
ZnF_C2H2 692 714 3.99e0 SMART
ZnF_C2H2 720 742 2.99e-4 SMART
ZnF_C2H2 752 774 1.6e-4 SMART
low complexity region 834 852 N/A INTRINSIC
low complexity region 901 923 N/A INTRINSIC
low complexity region 993 1007 N/A INTRINSIC
ZnF_C2H2 1061 1083 1.69e-3 SMART
ZnF_C2H2 1089 1111 5.99e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A T 16: 85,798,008 N617K probably benign Het
Adnp2 A T 18: 80,130,970 C75S probably damaging Het
Agmo T C 12: 37,357,674 F186L possibly damaging Het
Ahnak2 T C 12: 112,786,252 Y122C Het
Ahnak2 T C 12: 112,787,089 E71G Het
Aldh5a1 A G 13: 24,918,541 V313A probably damaging Het
Ankib1 C A 5: 3,772,643 C21F probably benign Het
Aqr A G 2: 114,118,877 Y947H probably damaging Het
Atp1a2 T A 1: 172,275,980 Y991F probably benign Het
Atp8b3 G A 10: 80,530,089 T309M possibly damaging Het
Blzf1 T A 1: 164,298,290 D259V possibly damaging Het
Cacng5 T C 11: 107,881,684 I113V probably benign Het
Catsper3 T C 13: 55,805,844 M269T probably benign Het
Ccdc142 A C 6: 83,102,252 Y190S probably damaging Het
Ccdc159 C A 9: 21,933,755 Q306K probably benign Het
Ccdc180 A T 4: 45,920,842 probably null Het
Cebpz A G 17: 78,921,652 F955S possibly damaging Het
Cftr C T 6: 18,274,697 T938I probably damaging Het
Col28a1 T C 6: 8,013,133 K973R probably benign Het
Cyp2c29 T C 19: 39,321,694 probably benign Het
Ddx1 A G 12: 13,243,858 probably benign Het
Duox2 A C 2: 122,289,345 Y867* probably null Het
Ereg T C 5: 91,089,154 Y111H possibly damaging Het
Esrrb T A 12: 86,518,950 L417Q probably damaging Het
Fbxw7 G A 3: 84,952,377 R2H unknown Het
Galnt6 C T 15: 100,694,620 V569I probably benign Het
Gm14226 G A 2: 155,024,174 C17Y unknown Het
Gpr150 T G 13: 76,056,523 D101A probably damaging Het
Grm1 A T 10: 10,689,552 L1004Q probably benign Het
Gtf2a1l T A 17: 88,714,923 D447E probably damaging Het
Gtf2ird1 C T 5: 134,415,210 V64M probably damaging Het
Ifi206 A T 1: 173,480,508 W641R Het
Ifi214 T A 1: 173,527,920 E107D possibly damaging Het
Kif19a T C 11: 114,784,773 V357A probably damaging Het
Klhdc7b T A 15: 89,386,822 S636T probably benign Het
Klhl25 C T 7: 75,865,672 R109C probably damaging Het
Ltbp2 T C 12: 84,806,350 E835G probably benign Het
March1 A G 8: 66,468,348 K226E probably damaging Het
Mcpt1 T C 14: 56,018,713 probably benign Het
Myrf C A 19: 10,215,070 R639L probably benign Het
Naip5 T C 13: 100,223,096 H544R possibly damaging Het
Nccrp1 T C 7: 28,546,344 I132V probably benign Het
Nprl3 C T 11: 32,237,334 V333I possibly damaging Het
Olfr1318 A T 2: 112,156,589 I213F probably damaging Het
Olfr1385 T A 11: 49,494,844 S104T probably benign Het
Olfr1394 T C 11: 49,160,470 M152T probably benign Het
Olfr300-ps1 T C 7: 86,443,715 S245P probably damaging Het
Olfr32 A T 2: 90,138,770 I123N probably damaging Het
Olfr539 C T 7: 140,668,139 S277L possibly damaging Het
Olfr648 T C 7: 104,179,818 N197D probably damaging Het
Olfr680-ps1 C A 7: 105,092,601 V73F possibly damaging Het
Olfr893 T C 9: 38,209,803 V248A probably benign Het
Olfr974 T C 9: 39,942,595 S112P probably damaging Het
Otx2 A G 14: 48,659,064 M179T probably damaging Het
Ppfia3 T A 7: 45,361,705 T34S probably benign Het
Prkcsh T C 9: 22,013,079 Y502H probably damaging Het
Psd T C 19: 46,313,336 E937G probably damaging Het
Rbbp6 T A 7: 123,001,753 I1661N unknown Het
Rhobtb1 T A 10: 69,270,757 M446K probably damaging Het
Slc12a9 C T 5: 137,327,654 V270I probably damaging Het
Slc6a15 A G 10: 103,389,251 K67E probably damaging Het
Slc9c1 A G 16: 45,560,283 D524G probably benign Het
Smpdl3a A G 10: 57,811,430 D418G probably benign Het
Sox6 T C 7: 115,597,508 T296A probably benign Het
Ssu2 T C 6: 112,384,438 E19G probably damaging Het
Tctn3 T C 19: 40,611,726 N90S probably damaging Het
Tex24 A G 8: 27,344,624 Q60R possibly damaging Het
Tlcd1 T A 11: 78,179,644 *128R probably null Het
Tti1 A C 2: 157,993,010 L1010R probably damaging Het
Ttn A G 2: 76,737,338 L27737P probably damaging Het
Ubqln5 T A 7: 104,129,115 K167N probably benign Het
Unkl A G 17: 25,231,715 I492V possibly damaging Het
Vmn1r8 G A 6: 57,036,680 V239I probably benign Het
Vmn2r101 T A 17: 19,591,135 L494I probably benign Het
Vmn2r54 G T 7: 12,635,950 T62K probably benign Het
Other mutations in Sall3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Sall3 APN 18 80973232 missense probably damaging 0.98
IGL01630:Sall3 APN 18 80971269 missense probably benign 0.03
IGL01713:Sall3 APN 18 80969847 missense probably damaging 1.00
IGL01803:Sall3 APN 18 80969832 missense possibly damaging 0.65
IGL02627:Sall3 APN 18 80972361 missense possibly damaging 0.86
IGL02858:Sall3 APN 18 80969513 missense probably damaging 1.00
IGL03177:Sall3 APN 18 80972968 missense probably benign 0.00
fountain UTSW 18 80974476 missense probably damaging 0.99
IGL02984:Sall3 UTSW 18 80973450 missense probably benign 0.01
R1055:Sall3 UTSW 18 80969792 missense probably benign 0.24
R1258:Sall3 UTSW 18 80974065 missense probably damaging 1.00
R1932:Sall3 UTSW 18 80969753 missense probably benign 0.44
R1976:Sall3 UTSW 18 80971893 missense probably benign 0.42
R2124:Sall3 UTSW 18 80971797 missense probably benign 0.01
R2142:Sall3 UTSW 18 80969831 missense probably damaging 0.98
R2199:Sall3 UTSW 18 80971870 missense probably benign 0.27
R2365:Sall3 UTSW 18 80971792 missense probably benign 0.01
R3856:Sall3 UTSW 18 80972502 missense probably damaging 1.00
R4022:Sall3 UTSW 18 80969840 missense probably benign 0.05
R4050:Sall3 UTSW 18 80971482 missense probably benign 0.03
R4085:Sall3 UTSW 18 80972133 missense probably damaging 0.99
R4764:Sall3 UTSW 18 80974476 missense probably damaging 0.99
R4874:Sall3 UTSW 18 80973973 missense probably benign 0.33
R4948:Sall3 UTSW 18 80971411 missense probably benign 0.20
R5274:Sall3 UTSW 18 80969837 missense probably benign 0.15
R5602:Sall3 UTSW 18 80972812 missense probably benign
R6063:Sall3 UTSW 18 80974255 missense possibly damaging 0.52
R6256:Sall3 UTSW 18 80969861 missense possibly damaging 0.74
R6431:Sall3 UTSW 18 80973187 missense possibly damaging 0.94
R6523:Sall3 UTSW 18 80973188 missense possibly damaging 0.68
R6719:Sall3 UTSW 18 80971506 missense probably damaging 0.99
R6861:Sall3 UTSW 18 80974375 nonsense probably null
R7078:Sall3 UTSW 18 80974099 missense probably damaging 0.97
R7107:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7108:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7453:Sall3 UTSW 18 80972040 missense probably benign 0.07
R7491:Sall3 UTSW 18 80972705 missense probably benign 0.03
R7496:Sall3 UTSW 18 80973364 missense probably benign 0.07
R7584:Sall3 UTSW 18 80974530 missense probably benign 0.00
R7599:Sall3 UTSW 18 80972052 missense possibly damaging 0.56
R7809:Sall3 UTSW 18 80974360 missense probably benign 0.00
R8244:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8245:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8250:Sall3 UTSW 18 80973528 missense probably benign 0.01
R8335:Sall3 UTSW 18 80969586 missense probably benign 0.35
R8360:Sall3 UTSW 18 80974017 missense probably benign 0.31
R8410:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8476:Sall3 UTSW 18 80972118 nonsense probably null
R8726:Sall3 UTSW 18 80986493 missense possibly damaging 0.89
Z1176:Sall3 UTSW 18 80972760 missense probably benign 0.19
Z1177:Sall3 UTSW 18 80974276 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGCCTACAGTGCTGGATGC -3'
(R):5'- TACCAATGTGACCCTGGAGACG -3'

Sequencing Primer
(F):5'- TGTGCCCCAGAATCAGGG -3'
(R):5'- CTGGAGACGCTGCTCAG -3'
Posted On2021-04-30