Incidental Mutation 'R8713:Mrpl44'
ID 669691
Institutional Source Beutler Lab
Gene Symbol Mrpl44
Ensembl Gene ENSMUSG00000026248
Gene Name mitochondrial ribosomal protein L44
Synonyms 1810030E18Rik, 5730593H20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8713 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 79776018-79781445 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 79777991 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 105 (R105C)
Ref Sequence ENSEMBL: ENSMUSP00000027464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027464] [ENSMUST00000143368]
AlphaFold Q9CY73
Predicted Effect probably damaging
Transcript: ENSMUST00000027464
AA Change: R105C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027464
Gene: ENSMUSG00000026248
AA Change: R105C

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
PDB:4CE4|H 67 333 1e-160 PDB
SCOP:d1jfza_ 72 224 5e-23 SMART
Blast:RIBOc 86 228 2e-90 BLAST
Blast:DSRM 237 288 6e-8 BLAST
SCOP:d1di2a_ 237 304 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143368
SMART Domains Protein: ENSMUSP00000123303
Gene: ENSMUSG00000073643

DomainStartEndE-ValueType
WD40 13 52 4.95e-4 SMART
WD40 56 96 5.5e1 SMART
WD40 103 142 1.19e0 SMART
Blast:WD40 145 182 6e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Adam18 T A 8: 24,652,173 M196L probably benign Het
Ankrd10 A G 8: 11,628,491 S134P probably damaging Het
Ano8 C T 8: 71,485,077 G47D probably damaging Het
Arl6ip4 T C 5: 124,116,762 V4A unknown Het
Cabp4 C T 19: 4,136,160 M247I probably benign Het
Ccdc30 A T 4: 119,404,207 L11Q probably damaging Het
Cdkl4 A G 17: 80,533,863 S288P possibly damaging Het
Celsr3 A G 9: 108,829,863 I1182V probably benign Het
Dnah17 T C 11: 118,088,202 D1788G probably damaging Het
Dsp A G 13: 38,168,725 D193G probably damaging Het
Dym T G 18: 75,056,738 Y132* probably null Het
Dync2h1 G A 9: 7,141,008 Q1340* probably null Het
Elmo1 T C 13: 20,274,621 probably benign Het
Fbxw15 A C 9: 109,555,599 F378V possibly damaging Het
Fsip2 G A 2: 82,981,109 G2591R probably damaging Het
Gps2 C A 11: 69,915,354 D148E probably benign Het
Iars2 T C 1: 185,291,418 D772G possibly damaging Het
Ifit1 T A 19: 34,647,638 L58Q probably benign Het
Kctd4 A T 14: 75,962,926 Q112H probably benign Het
Letm1 A G 5: 33,762,505 L230P probably damaging Het
Lrch4 G T 5: 137,639,863 E136* probably null Het
Macc1 T C 12: 119,443,526 probably benign Het
Macrod1 T C 19: 7,057,126 L79P probably benign Het
Map2 T A 1: 66,414,622 N890K probably damaging Het
Mctp1 G A 13: 76,641,803 S270N probably benign Het
Mtg1 T A 7: 140,137,775 probably null Het
Mtg1 T C 7: 140,140,223 F68L probably benign Het
Nfil3 A G 13: 52,968,011 S286P possibly damaging Het
Nutm1 A G 2: 112,251,322 V332A possibly damaging Het
Obscn T A 11: 59,135,966 Q137L probably benign Het
Pcnx2 T G 8: 125,818,786 E1162A probably damaging Het
Pgr A G 9: 8,900,817 D117G possibly damaging Het
Plce1 T C 19: 38,524,901 C215R probably benign Het
Rrm1 T G 7: 102,460,351 Y461D probably damaging Het
Sbk3 C T 7: 4,969,992 V60I possibly damaging Het
Scube1 G T 15: 83,610,270 A852E possibly damaging Het
Sec24d T A 3: 123,343,892 I561N probably damaging Het
Slc16a4 T C 3: 107,311,585 *501Q probably null Het
Slc6a19 C A 13: 73,700,621 V5L probably benign Het
Spryd3 A G 15: 102,133,485 I34T possibly damaging Het
Syne1 A G 10: 5,316,040 L2191P probably damaging Het
Tbrg1 A G 9: 37,652,659 C227R probably damaging Het
Tdrd6 A G 17: 43,625,019 S1713P probably benign Het
Thap12 C T 7: 98,707,076 L57F probably benign Het
Top1 G A 2: 160,717,440 V628I probably damaging Het
Trim67 A G 8: 124,820,335 M495V probably null Het
Trio A C 15: 27,743,951 probably benign Het
Vmn2r23 A T 6: 123,703,032 Y71F Het
Ywhah A G 5: 33,027,191 N246S probably benign Het
Zcwpw1 T C 5: 137,799,532 I125T probably benign Het
Other mutations in Mrpl44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Mrpl44 APN 1 79781004 missense probably benign 0.01
IGL02633:Mrpl44 APN 1 79776145 missense probably benign 0.02
R0054:Mrpl44 UTSW 1 79779495 missense probably damaging 1.00
R0054:Mrpl44 UTSW 1 79779495 missense probably damaging 1.00
R0909:Mrpl44 UTSW 1 79779653 missense probably benign 0.43
R1180:Mrpl44 UTSW 1 79777960 missense probably damaging 0.99
R1347:Mrpl44 UTSW 1 79777952 missense probably damaging 1.00
R1347:Mrpl44 UTSW 1 79777952 missense probably damaging 1.00
R1448:Mrpl44 UTSW 1 79777960 missense probably damaging 0.99
R3689:Mrpl44 UTSW 1 79779649 nonsense probably null
R3690:Mrpl44 UTSW 1 79779649 nonsense probably null
R4533:Mrpl44 UTSW 1 79776254 missense possibly damaging 0.91
R4818:Mrpl44 UTSW 1 79780977 missense probably benign 0.00
R4893:Mrpl44 UTSW 1 79777865 missense probably damaging 0.97
R6178:Mrpl44 UTSW 1 79778178 missense possibly damaging 0.76
R8795:Mrpl44 UTSW 1 79776257 missense probably damaging 0.99
X0018:Mrpl44 UTSW 1 79778075 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACCTTACGTGGTACCATGC -3'
(R):5'- TCTGCACTGAGGGTCAACTG -3'

Sequencing Primer
(F):5'- ACGTGGTACCATGCCCTCC -3'
(R):5'- ACTGAGGGTCAACTGCTCCAC -3'
Posted On 2021-04-30