Incidental Mutation 'R8713:Slc16a4'
ID669696
Institutional Source Beutler Lab
Gene Symbol Slc16a4
Ensembl Gene ENSMUSG00000027896
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8713 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location107291230-107312115 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 107311585 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 501 (*501Q)
Ref Sequence ENSEMBL: ENSMUSP00000029502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029502] [ENSMUST00000106723]
Predicted Effect probably null
Transcript: ENSMUST00000029502
AA Change: *501Q
SMART Domains Protein: ENSMUSP00000029502
Gene: ENSMUSG00000027896
AA Change: *501Q

DomainStartEndE-ValueType
Pfam:MFS_1 27 373 8.2e-26 PFAM
Pfam:MFS_1 305 499 2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106723
SMART Domains Protein: ENSMUSP00000102334
Gene: ENSMUSG00000027896

DomainStartEndE-ValueType
Pfam:MFS_1 27 375 2.1e-28 PFAM
Pfam:MFS_1 327 462 3.6e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Adam18 T A 8: 24,652,173 M196L probably benign Het
Ankrd10 A G 8: 11,628,491 S134P probably damaging Het
Ano8 C T 8: 71,485,077 G47D probably damaging Het
Arl6ip4 T C 5: 124,116,762 V4A unknown Het
Cabp4 C T 19: 4,136,160 M247I probably benign Het
Ccdc30 A T 4: 119,404,207 L11Q probably damaging Het
Cdkl4 A G 17: 80,533,863 S288P possibly damaging Het
Celsr3 A G 9: 108,829,863 I1182V probably benign Het
Dnah17 T C 11: 118,088,202 D1788G probably damaging Het
Dsp A G 13: 38,168,725 D193G probably damaging Het
Dym T G 18: 75,056,738 Y132* probably null Het
Dync2h1 G A 9: 7,141,008 Q1340* probably null Het
Elmo1 T C 13: 20,274,621 probably benign Het
Fbxw15 A C 9: 109,555,599 F378V possibly damaging Het
Fsip2 G A 2: 82,981,109 G2591R probably damaging Het
Gps2 C A 11: 69,915,354 D148E probably benign Het
Iars2 T C 1: 185,291,418 D772G possibly damaging Het
Ifit1 T A 19: 34,647,638 L58Q probably benign Het
Kctd4 A T 14: 75,962,926 Q112H probably benign Het
Letm1 A G 5: 33,762,505 L230P probably damaging Het
Lrch4 G T 5: 137,639,863 E136* probably null Het
Macc1 T C 12: 119,443,526 probably benign Het
Macrod1 T C 19: 7,057,126 L79P probably benign Het
Map2 T A 1: 66,414,622 N890K probably damaging Het
Mctp1 G A 13: 76,641,803 S270N probably benign Het
Mrpl44 C T 1: 79,777,991 R105C probably damaging Het
Mtg1 T A 7: 140,137,775 probably null Het
Mtg1 T C 7: 140,140,223 F68L probably benign Het
Nfil3 A G 13: 52,968,011 S286P possibly damaging Het
Nutm1 A G 2: 112,251,322 V332A possibly damaging Het
Obscn T A 11: 59,135,966 Q137L probably benign Het
Pcnx2 T G 8: 125,818,786 E1162A probably damaging Het
Pgr A G 9: 8,900,817 D117G possibly damaging Het
Plce1 T C 19: 38,524,901 C215R probably benign Het
Rrm1 T G 7: 102,460,351 Y461D probably damaging Het
Sbk3 C T 7: 4,969,992 V60I possibly damaging Het
Scube1 G T 15: 83,610,270 A852E possibly damaging Het
Sec24d T A 3: 123,343,892 I561N probably damaging Het
Slc6a19 C A 13: 73,700,621 V5L probably benign Het
Spryd3 A G 15: 102,133,485 I34T possibly damaging Het
Syne1 A G 10: 5,316,040 L2191P probably damaging Het
Tbrg1 A G 9: 37,652,659 C227R probably damaging Het
Tdrd6 A G 17: 43,625,019 S1713P probably benign Het
Thap12 C T 7: 98,707,076 L57F probably benign Het
Top1 G A 2: 160,717,440 V628I probably damaging Het
Trim67 A G 8: 124,820,335 M495V probably null Het
Trio A C 15: 27,743,951 probably benign Het
Vmn2r23 A T 6: 123,703,032 Y71F Het
Ywhah A G 5: 33,027,191 N246S probably benign Het
Zc3h18 TGAGGAGGAGGAGGAG TGAGGAGGAGGAG 8: 122,383,857 probably benign Het
Zcwpw1 T C 5: 137,799,532 I125T probably benign Het
Other mutations in Slc16a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Slc16a4 APN 3 107303100 missense possibly damaging 0.67
IGL01311:Slc16a4 APN 3 107292505 missense possibly damaging 0.83
IGL01509:Slc16a4 APN 3 107311434 critical splice acceptor site probably null
IGL01780:Slc16a4 APN 3 107303099 missense probably benign 0.00
IGL02294:Slc16a4 APN 3 107301068 missense probably benign 0.00
IGL02350:Slc16a4 APN 3 107303099 missense probably benign 0.00
IGL02357:Slc16a4 APN 3 107303099 missense probably benign 0.00
IGL02792:Slc16a4 APN 3 107298877 missense probably benign
IGL02873:Slc16a4 APN 3 107300795 missense probably benign 0.00
IGL03001:Slc16a4 APN 3 107311542 missense possibly damaging 0.91
IGL03002:Slc16a4 APN 3 107300786 missense probably benign 0.07
R0370:Slc16a4 UTSW 3 107301097 missense possibly damaging 0.66
R0525:Slc16a4 UTSW 3 107297939 splice site probably benign
R1192:Slc16a4 UTSW 3 107298873 missense probably benign 0.07
R1458:Slc16a4 UTSW 3 107300932 missense probably benign 0.00
R1939:Slc16a4 UTSW 3 107301001 missense probably benign 0.00
R2061:Slc16a4 UTSW 3 107300711 missense probably benign 0.00
R2098:Slc16a4 UTSW 3 107300847 nonsense probably null
R2102:Slc16a4 UTSW 3 107304503 splice site probably null
R3411:Slc16a4 UTSW 3 107300872 missense probably benign
R4983:Slc16a4 UTSW 3 107300860 missense probably benign 0.00
R5394:Slc16a4 UTSW 3 107292442 missense probably benign
R5804:Slc16a4 UTSW 3 107298964 missense probably benign 0.04
R6077:Slc16a4 UTSW 3 107301065 missense possibly damaging 0.91
R6626:Slc16a4 UTSW 3 107301196 missense possibly damaging 0.95
R6693:Slc16a4 UTSW 3 107303064 missense probably damaging 1.00
R6811:Slc16a4 UTSW 3 107298917 missense probably benign 0.06
R6823:Slc16a4 UTSW 3 107311498 missense probably benign 0.02
R6982:Slc16a4 UTSW 3 107299273 missense probably benign 0.01
R7050:Slc16a4 UTSW 3 107300832 missense probably benign
R7103:Slc16a4 UTSW 3 107311471 missense probably damaging 1.00
R7608:Slc16a4 UTSW 3 107303127 missense probably damaging 1.00
R7623:Slc16a4 UTSW 3 107297981 missense possibly damaging 0.71
R8013:Slc16a4 UTSW 3 107311478 missense probably damaging 1.00
R8014:Slc16a4 UTSW 3 107311478 missense probably damaging 1.00
X0018:Slc16a4 UTSW 3 107300815 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAAATCATTCCTACCTTGCAGG -3'
(R):5'- AGTAAAGGAGCTGCTTCAATGGATTC -3'

Sequencing Primer
(F):5'- CCTACCTTGCAGGCTGGATATATG -3'
(R):5'- CTTCAATGGATTCAGTTTGTAGCC -3'
Posted On2021-04-30