Incidental Mutation 'R8713:Sec24d'
ID 669697
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene Name Sec24 related gene family, member D (S. cerevisiae)
Synonyms 2310020L09Rik, LOC383951
MMRRC Submission 068567-MU
Accession Numbers

Genbank: NM_027135; MGI: 1916858
Essential gene? Essential (E-score: 1.000) question?
Stock # R8713 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 123267455-123365641 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 123343892 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 561 (I561N)
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
AlphaFold Q6NXL1
Predicted Effect probably damaging
Transcript: ENSMUST00000047923
AA Change: I561N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: I561N

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Adam18 T A 8: 24,652,173 M196L probably benign Het
Ankrd10 A G 8: 11,628,491 S134P probably damaging Het
Ano8 C T 8: 71,485,077 G47D probably damaging Het
Arl6ip4 T C 5: 124,116,762 V4A unknown Het
Cabp4 C T 19: 4,136,160 M247I probably benign Het
Ccdc30 A T 4: 119,404,207 L11Q probably damaging Het
Cdkl4 A G 17: 80,533,863 S288P possibly damaging Het
Celsr3 A G 9: 108,829,863 I1182V probably benign Het
Dnah17 T C 11: 118,088,202 D1788G probably damaging Het
Dsp A G 13: 38,168,725 D193G probably damaging Het
Dym T G 18: 75,056,738 Y132* probably null Het
Dync2h1 G A 9: 7,141,008 Q1340* probably null Het
Elmo1 T C 13: 20,274,621 probably benign Het
Fbxw15 A C 9: 109,555,599 F378V possibly damaging Het
Fsip2 G A 2: 82,981,109 G2591R probably damaging Het
Gps2 C A 11: 69,915,354 D148E probably benign Het
Iars2 T C 1: 185,291,418 D772G possibly damaging Het
Ifit1 T A 19: 34,647,638 L58Q probably benign Het
Kctd4 A T 14: 75,962,926 Q112H probably benign Het
Letm1 A G 5: 33,762,505 L230P probably damaging Het
Lrch4 G T 5: 137,639,863 E136* probably null Het
Macc1 T C 12: 119,443,526 probably benign Het
Macrod1 T C 19: 7,057,126 L79P probably benign Het
Map2 T A 1: 66,414,622 N890K probably damaging Het
Mctp1 G A 13: 76,641,803 S270N probably benign Het
Mrpl44 C T 1: 79,777,991 R105C probably damaging Het
Mtg1 T A 7: 140,137,775 probably null Het
Mtg1 T C 7: 140,140,223 F68L probably benign Het
Nfil3 A G 13: 52,968,011 S286P possibly damaging Het
Nutm1 A G 2: 112,251,322 V332A possibly damaging Het
Obscn T A 11: 59,135,966 Q137L probably benign Het
Pcnx2 T G 8: 125,818,786 E1162A probably damaging Het
Pgr A G 9: 8,900,817 D117G possibly damaging Het
Plce1 T C 19: 38,524,901 C215R probably benign Het
Rrm1 T G 7: 102,460,351 Y461D probably damaging Het
Sbk3 C T 7: 4,969,992 V60I possibly damaging Het
Scube1 G T 15: 83,610,270 A852E possibly damaging Het
Slc16a4 T C 3: 107,311,585 *501Q probably null Het
Slc6a19 C A 13: 73,700,621 V5L probably benign Het
Spryd3 A G 15: 102,133,485 I34T possibly damaging Het
Syne1 A G 10: 5,316,040 L2191P probably damaging Het
Tbrg1 A G 9: 37,652,659 C227R probably damaging Het
Tdrd6 A G 17: 43,625,019 S1713P probably benign Het
Thap12 C T 7: 98,707,076 L57F probably benign Het
Top1 G A 2: 160,717,440 V628I probably damaging Het
Trim67 A G 8: 124,820,335 M495V probably null Het
Trio A C 15: 27,743,951 probably benign Het
Vmn2r23 A T 6: 123,703,032 Y71F Het
Ywhah A G 5: 33,027,191 N246S probably benign Het
Zcwpw1 T C 5: 137,799,532 I125T probably benign Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123350009 missense probably benign 0.00
IGL01621:Sec24d APN 3 123294158 critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123293595 nonsense probably null
IGL02064:Sec24d APN 3 123343814 splice site probably benign
IGL02125:Sec24d APN 3 123358958 missense probably damaging 1.00
IGL02173:Sec24d APN 3 123353681 missense probably damaging 1.00
IGL03239:Sec24d APN 3 123336489 missense probably benign 0.00
Scanty UTSW 3 123354947 missense probably damaging 1.00
3-1:Sec24d UTSW 3 123353630 missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123343178 missense probably damaging 1.00
R0008:Sec24d UTSW 3 123350876 splice site probably benign
R0838:Sec24d UTSW 3 123305836 missense probably benign 0.08
R1775:Sec24d UTSW 3 123336517 missense probably damaging 1.00
R1895:Sec24d UTSW 3 123353394 missense probably benign 0.04
R1946:Sec24d UTSW 3 123353394 missense probably benign 0.04
R2238:Sec24d UTSW 3 123349894 splice site probably null
R2504:Sec24d UTSW 3 123353606 missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123350746 missense probably damaging 0.98
R2895:Sec24d UTSW 3 123343151 missense probably damaging 1.00
R3428:Sec24d UTSW 3 123343923 splice site probably benign
R4573:Sec24d UTSW 3 123358870 missense probably damaging 1.00
R4668:Sec24d UTSW 3 123355774 missense probably damaging 0.98
R4706:Sec24d UTSW 3 123355778 missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123354947 missense probably damaging 1.00
R4982:Sec24d UTSW 3 123299606 missense probably benign 0.29
R5030:Sec24d UTSW 3 123358901 missense probably damaging 0.98
R5041:Sec24d UTSW 3 123294231 missense probably damaging 0.96
R5078:Sec24d UTSW 3 123290552 missense probably benign 0.00
R5108:Sec24d UTSW 3 123305785 splice site probably null
R5174:Sec24d UTSW 3 123364926 missense probably damaging 0.99
R5661:Sec24d UTSW 3 123343085 missense probably damaging 1.00
R5661:Sec24d UTSW 3 123343142 missense possibly damaging 0.95
R5775:Sec24d UTSW 3 123290460 missense probably benign 0.00
R5859:Sec24d UTSW 3 123279312 unclassified probably benign
R5944:Sec24d UTSW 3 123293581 missense probably benign 0.01
R6053:Sec24d UTSW 3 123279222 nonsense probably null
R6515:Sec24d UTSW 3 123343070 missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123290552 missense probably benign 0.00
R6557:Sec24d UTSW 3 123343087 missense probably damaging 1.00
R6593:Sec24d UTSW 3 123353412 missense probably damaging 1.00
R6594:Sec24d UTSW 3 123293763 missense probably damaging 1.00
R6842:Sec24d UTSW 3 123343219 missense probably benign 0.00
R7072:Sec24d UTSW 3 123330351 missense probably damaging 1.00
R7481:Sec24d UTSW 3 123350763 missense probably damaging 1.00
R7554:Sec24d UTSW 3 123355774 missense probably damaging 1.00
R8270:Sec24d UTSW 3 123305886 missense possibly damaging 0.90
R8481:Sec24d UTSW 3 123353424 missense probably damaging 1.00
R8872:Sec24d UTSW 3 123354936 splice site probably benign
R8922:Sec24d UTSW 3 123350839 missense probably damaging 1.00
R8974:Sec24d UTSW 3 123305849 missense probably damaging 1.00
R9015:Sec24d UTSW 3 123327638 missense probably benign 0.43
R9050:Sec24d UTSW 3 123350725 missense probably benign 0.00
R9065:Sec24d UTSW 3 123355803 missense probably damaging 1.00
R9128:Sec24d UTSW 3 123294161 missense probably benign
R9447:Sec24d UTSW 3 123290513 missense probably benign 0.00
R9701:Sec24d UTSW 3 123269672 missense probably damaging 1.00
R9758:Sec24d UTSW 3 123343154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCAGTTACCCACACATGC -3'
(R):5'- GACAGTGCCTGGGTCTAAAC -3'

Sequencing Primer
(F):5'- GTTACCCACACATGCTGTTTATCAAG -3'
(R):5'- CACAGAGAGTGCTTGTGGC -3'
Posted On 2021-04-30