Incidental Mutation 'R8713:Letm1'
ID669700
Institutional Source Beutler Lab
Gene Symbol Letm1
Ensembl Gene ENSMUSG00000005299
Gene Nameleucine zipper-EF-hand containing transmembrane protein 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R8713 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location33739673-33782817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33762505 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 230 (L230P)
Ref Sequence ENSEMBL: ENSMUSP00000005431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005431]
Predicted Effect probably damaging
Transcript: ENSMUST00000005431
AA Change: L230P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005431
Gene: ENSMUSG00000005299
AA Change: L230P

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
Pfam:LETM1 152 417 1.2e-111 PFAM
coiled coil region 445 493 N/A INTRINSIC
low complexity region 503 513 N/A INTRINSIC
coiled coil region 537 598 N/A INTRINSIC
SCOP:d1c7va_ 647 691 4e-3 SMART
coiled coil region 708 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200827
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to the inner mitochondrial membrane. The protein functions to maintain the mitochondrial tubular shapes and is required for normal mitochondrial morphology and cellular viability. Mutations in this gene cause Wolf-Hirschhorn syndrome, a complex malformation syndrome caused by the deletion of parts of the distal short arm of chromosome 4. Related pseudogenes have been identified on chromosomes 8, 15 and 19. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality prior to E6.5 while ~50% of heterozygotes die before E13.5. Surviving heterozygous mice show altered glucose metabolism, impaired control of brain ATP levels, and increased susceptibility to kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Adam18 T A 8: 24,652,173 M196L probably benign Het
Ankrd10 A G 8: 11,628,491 S134P probably damaging Het
Ano8 C T 8: 71,485,077 G47D probably damaging Het
Arl6ip4 T C 5: 124,116,762 V4A unknown Het
Cabp4 C T 19: 4,136,160 M247I probably benign Het
Ccdc30 A T 4: 119,404,207 L11Q probably damaging Het
Cdkl4 A G 17: 80,533,863 S288P possibly damaging Het
Celsr3 A G 9: 108,829,863 I1182V probably benign Het
Dnah17 T C 11: 118,088,202 D1788G probably damaging Het
Dsp A G 13: 38,168,725 D193G probably damaging Het
Dym T G 18: 75,056,738 Y132* probably null Het
Dync2h1 G A 9: 7,141,008 Q1340* probably null Het
Elmo1 T C 13: 20,274,621 probably benign Het
Fbxw15 A C 9: 109,555,599 F378V possibly damaging Het
Fsip2 G A 2: 82,981,109 G2591R probably damaging Het
Gps2 C A 11: 69,915,354 D148E probably benign Het
Iars2 T C 1: 185,291,418 D772G possibly damaging Het
Ifit1 T A 19: 34,647,638 L58Q probably benign Het
Kctd4 A T 14: 75,962,926 Q112H probably benign Het
Lrch4 G T 5: 137,639,863 E136* probably null Het
Macc1 T C 12: 119,443,526 probably benign Het
Macrod1 T C 19: 7,057,126 L79P probably benign Het
Map2 T A 1: 66,414,622 N890K probably damaging Het
Mctp1 G A 13: 76,641,803 S270N probably benign Het
Mrpl44 C T 1: 79,777,991 R105C probably damaging Het
Mtg1 T A 7: 140,137,775 probably null Het
Mtg1 T C 7: 140,140,223 F68L probably benign Het
Nfil3 A G 13: 52,968,011 S286P possibly damaging Het
Nutm1 A G 2: 112,251,322 V332A possibly damaging Het
Obscn T A 11: 59,135,966 Q137L probably benign Het
Pcnx2 T G 8: 125,818,786 E1162A probably damaging Het
Pgr A G 9: 8,900,817 D117G possibly damaging Het
Plce1 T C 19: 38,524,901 C215R probably benign Het
Rrm1 T G 7: 102,460,351 Y461D probably damaging Het
Sbk3 C T 7: 4,969,992 V60I possibly damaging Het
Scube1 G T 15: 83,610,270 A852E possibly damaging Het
Sec24d T A 3: 123,343,892 I561N probably damaging Het
Slc16a4 T C 3: 107,311,585 *501Q probably null Het
Slc6a19 C A 13: 73,700,621 V5L probably benign Het
Spryd3 A G 15: 102,133,485 I34T possibly damaging Het
Syne1 A G 10: 5,316,040 L2191P probably damaging Het
Tbrg1 A G 9: 37,652,659 C227R probably damaging Het
Tdrd6 A G 17: 43,625,019 S1713P probably benign Het
Thap12 C T 7: 98,707,076 L57F probably benign Het
Top1 G A 2: 160,717,440 V628I probably damaging Het
Trim67 A G 8: 124,820,335 M495V probably null Het
Trio A C 15: 27,743,951 probably benign Het
Vmn2r23 A T 6: 123,703,032 Y71F Het
Ywhah A G 5: 33,027,191 N246S probably benign Het
Zc3h18 TGAGGAGGAGGAGGAG TGAGGAGGAGGAG 8: 122,383,857 probably benign Het
Zcwpw1 T C 5: 137,799,532 I125T probably benign Het
Other mutations in Letm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Letm1 APN 5 33762590 missense possibly damaging 0.82
IGL01073:Letm1 APN 5 33748800 missense possibly damaging 0.89
IGL01882:Letm1 APN 5 33769665 missense probably benign 0.00
IGL02186:Letm1 APN 5 33745047 missense probably benign 0.00
IGL02699:Letm1 APN 5 33745148 missense possibly damaging 0.93
IGL03089:Letm1 APN 5 33760858 missense probably damaging 1.00
R0466:Letm1 UTSW 5 33761730 splice site probably benign
R0639:Letm1 UTSW 5 33769426 missense possibly damaging 0.88
R1370:Letm1 UTSW 5 33778682 splice site probably null
R1415:Letm1 UTSW 5 33769562 missense probably benign 0.06
R1511:Letm1 UTSW 5 33752555 missense probably damaging 1.00
R1714:Letm1 UTSW 5 33760884 missense possibly damaging 0.51
R1771:Letm1 UTSW 5 33769467 missense probably damaging 1.00
R1990:Letm1 UTSW 5 33769515 frame shift probably null
R1991:Letm1 UTSW 5 33769515 frame shift probably null
R2143:Letm1 UTSW 5 33769515 frame shift probably null
R2145:Letm1 UTSW 5 33769515 frame shift probably null
R2202:Letm1 UTSW 5 33769486 missense possibly damaging 0.64
R2290:Letm1 UTSW 5 33769515 frame shift probably null
R2292:Letm1 UTSW 5 33769515 frame shift probably null
R5574:Letm1 UTSW 5 33769386 missense possibly damaging 0.46
R6954:Letm1 UTSW 5 33782507 missense probably benign 0.35
R7265:Letm1 UTSW 5 33778648 missense possibly damaging 0.62
S24628:Letm1 UTSW 5 33747444 missense probably benign 0.00
S24628:Letm1 UTSW 5 33747446 missense probably benign
X0066:Letm1 UTSW 5 33762571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAATCCCTAGCCCTACC -3'
(R):5'- TCACCATGTTGCTCAGTTTGTAG -3'

Sequencing Primer
(F):5'- GATCAGAGGATACCTTGGTCCTTAC -3'
(R):5'- TTTGTAGTGAGGGTGGGAGAAATACC -3'
Posted On2021-04-30