Incidental Mutation 'R8713:Arl6ip4'
ID 669702
Institutional Source Beutler Lab
Gene Symbol Arl6ip4
Ensembl Gene ENSMUSG00000029404
Gene Name ADP-ribosylation factor-like 6 interacting protein 4
Synonyms Srp25, Aip-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock # R8713 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 124116089-124118196 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124116762 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 4 (V4A)
Ref Sequence ENSEMBL: ENSMUSP00000122377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024470] [ENSMUST00000031351] [ENSMUST00000086123] [ENSMUST00000119269] [ENSMUST00000122394] [ENSMUST00000145667] [ENSMUST00000149835] [ENSMUST00000161273] [ENSMUST00000161938] [ENSMUST00000162812] [ENSMUST00000196401] [ENSMUST00000196627] [ENSMUST00000198505] [ENSMUST00000198770]
AlphaFold Q9JM93
Predicted Effect probably benign
Transcript: ENSMUST00000024470
SMART Domains Protein: ENSMUSP00000024470
Gene: ENSMUSG00000023707

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:P4Hc 42 100 2e-6 BLAST
low complexity region 102 112 N/A INTRINSIC
P4Hc 136 307 7.91e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031351
SMART Domains Protein: ENSMUSP00000031351
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
Pfam:SR-25 7 227 2.7e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086123
SMART Domains Protein: ENSMUSP00000083292
Gene: ENSMUSG00000029406

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119269
SMART Domains Protein: ENSMUSP00000112701
Gene: ENSMUSG00000023707

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:P4Hc 42 133 1e-22 BLAST
Blast:P4Hc 136 175 1e-20 BLAST
low complexity region 176 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122394
SMART Domains Protein: ENSMUSP00000112506
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
Pfam:SR-25 2 199 6.3e-85 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000145667
AA Change: V4A
SMART Domains Protein: ENSMUSP00000122377
Gene: ENSMUSG00000029404
AA Change: V4A

DomainStartEndE-ValueType
Pfam:SR-25 19 227 3e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149835
SMART Domains Protein: ENSMUSP00000116269
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
low complexity region 5 32 N/A INTRINSIC
SCOP:d1l9ha_ 58 84 7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161273
SMART Domains Protein: ENSMUSP00000124292
Gene: ENSMUSG00000029406

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-129 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 945 7.5e-100 SMART
LNS2 1090 1221 3.1e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161938
SMART Domains Protein: ENSMUSP00000124111
Gene: ENSMUSG00000029406

DomainStartEndE-ValueType
Pfam:IP_trans 1 251 7.5e-116 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 949 8.37e-104 SMART
LNS2 1094 1225 3.22e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162812
SMART Domains Protein: ENSMUSP00000124740
Gene: ENSMUSG00000029406

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196401
SMART Domains Protein: ENSMUSP00000142496
Gene: ENSMUSG00000029404

DomainStartEndE-ValueType
low complexity region 29 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196627
SMART Domains Protein: ENSMUSP00000143698
Gene: ENSMUSG00000023707

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Blast:P4Hc 42 133 1e-23 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198505
SMART Domains Protein: ENSMUSP00000142965
Gene: ENSMUSG00000023707

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198770
SMART Domains Protein: ENSMUSP00000143318
Gene: ENSMUSG00000023707

DomainStartEndE-ValueType
Blast:P4Hc 11 102 7e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000199457
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Adam18 T A 8: 24,652,173 M196L probably benign Het
Ankrd10 A G 8: 11,628,491 S134P probably damaging Het
Ano8 C T 8: 71,485,077 G47D probably damaging Het
Cabp4 C T 19: 4,136,160 M247I probably benign Het
Ccdc30 A T 4: 119,404,207 L11Q probably damaging Het
Cdkl4 A G 17: 80,533,863 S288P possibly damaging Het
Celsr3 A G 9: 108,829,863 I1182V probably benign Het
Dnah17 T C 11: 118,088,202 D1788G probably damaging Het
Dsp A G 13: 38,168,725 D193G probably damaging Het
Dym T G 18: 75,056,738 Y132* probably null Het
Dync2h1 G A 9: 7,141,008 Q1340* probably null Het
Elmo1 T C 13: 20,274,621 probably benign Het
Fbxw15 A C 9: 109,555,599 F378V possibly damaging Het
Fsip2 G A 2: 82,981,109 G2591R probably damaging Het
Gps2 C A 11: 69,915,354 D148E probably benign Het
Iars2 T C 1: 185,291,418 D772G possibly damaging Het
Ifit1 T A 19: 34,647,638 L58Q probably benign Het
Kctd4 A T 14: 75,962,926 Q112H probably benign Het
Letm1 A G 5: 33,762,505 L230P probably damaging Het
Lrch4 G T 5: 137,639,863 E136* probably null Het
Macc1 T C 12: 119,443,526 probably benign Het
Macrod1 T C 19: 7,057,126 L79P probably benign Het
Map2 T A 1: 66,414,622 N890K probably damaging Het
Mctp1 G A 13: 76,641,803 S270N probably benign Het
Mrpl44 C T 1: 79,777,991 R105C probably damaging Het
Mtg1 T A 7: 140,137,775 probably null Het
Mtg1 T C 7: 140,140,223 F68L probably benign Het
Nfil3 A G 13: 52,968,011 S286P possibly damaging Het
Nutm1 A G 2: 112,251,322 V332A possibly damaging Het
Obscn T A 11: 59,135,966 Q137L probably benign Het
Pcnx2 T G 8: 125,818,786 E1162A probably damaging Het
Pgr A G 9: 8,900,817 D117G possibly damaging Het
Plce1 T C 19: 38,524,901 C215R probably benign Het
Rrm1 T G 7: 102,460,351 Y461D probably damaging Het
Sbk3 C T 7: 4,969,992 V60I possibly damaging Het
Scube1 G T 15: 83,610,270 A852E possibly damaging Het
Sec24d T A 3: 123,343,892 I561N probably damaging Het
Slc16a4 T C 3: 107,311,585 *501Q probably null Het
Slc6a19 C A 13: 73,700,621 V5L probably benign Het
Spryd3 A G 15: 102,133,485 I34T possibly damaging Het
Syne1 A G 10: 5,316,040 L2191P probably damaging Het
Tbrg1 A G 9: 37,652,659 C227R probably damaging Het
Tdrd6 A G 17: 43,625,019 S1713P probably benign Het
Thap12 C T 7: 98,707,076 L57F probably benign Het
Top1 G A 2: 160,717,440 V628I probably damaging Het
Trim67 A G 8: 124,820,335 M495V probably null Het
Trio A C 15: 27,743,951 probably benign Het
Vmn2r23 A T 6: 123,703,032 Y71F Het
Ywhah A G 5: 33,027,191 N246S probably benign Het
Zcwpw1 T C 5: 137,799,532 I125T probably benign Het
Other mutations in Arl6ip4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03079:Arl6ip4 APN 5 124116927 missense possibly damaging 0.93
R0612:Arl6ip4 UTSW 5 124116533 missense probably benign 0.32
R2436:Arl6ip4 UTSW 5 124116599 missense probably benign 0.19
R6030:Arl6ip4 UTSW 5 124117905 critical splice donor site probably null
R6030:Arl6ip4 UTSW 5 124117905 critical splice donor site probably null
R6762:Arl6ip4 UTSW 5 124117050 unclassified probably benign
R6789:Arl6ip4 UTSW 5 124116602 missense probably damaging 1.00
R6906:Arl6ip4 UTSW 5 124116551 missense possibly damaging 0.45
R8190:Arl6ip4 UTSW 5 124117032 missense probably damaging 0.98
R8777:Arl6ip4 UTSW 5 124116548 missense probably benign 0.02
R8777-TAIL:Arl6ip4 UTSW 5 124116548 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTGTTCAGCCTCCAGATCC -3'
(R):5'- TGAACTGGATCGCGATGTC -3'

Sequencing Primer
(F):5'- AGATCCCAGGGCCACAAGG -3'
(R):5'- AACTGGATCGCGATGTCCTCTG -3'
Posted On 2021-04-30