Incidental Mutation 'R8713:Zcwpw1'
ID 669704
Institutional Source Beutler Lab
Gene Symbol Zcwpw1
Ensembl Gene ENSMUSG00000037108
Gene Name zinc finger, CW type with PWWP domain 1
Synonyms LOC381678
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock # R8713 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 137787798-137822621 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 137799532 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 125 (I125T)
Ref Sequence ENSEMBL: ENSMUSP00000048730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035852]
AlphaFold Q6IR42
Predicted Effect probably benign
Transcript: ENSMUST00000035852
AA Change: I125T

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000048730
Gene: ENSMUSG00000037108
AA Change: I125T

DomainStartEndE-ValueType
Pfam:zf-CW 246 293 7.3e-18 PFAM
Pfam:PWWP 306 401 6.9e-22 PFAM
coiled coil region 440 462 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Adam18 T A 8: 24,652,173 M196L probably benign Het
Ankrd10 A G 8: 11,628,491 S134P probably damaging Het
Ano8 C T 8: 71,485,077 G47D probably damaging Het
Arl6ip4 T C 5: 124,116,762 V4A unknown Het
Cabp4 C T 19: 4,136,160 M247I probably benign Het
Ccdc30 A T 4: 119,404,207 L11Q probably damaging Het
Cdkl4 A G 17: 80,533,863 S288P possibly damaging Het
Celsr3 A G 9: 108,829,863 I1182V probably benign Het
Dnah17 T C 11: 118,088,202 D1788G probably damaging Het
Dsp A G 13: 38,168,725 D193G probably damaging Het
Dym T G 18: 75,056,738 Y132* probably null Het
Dync2h1 G A 9: 7,141,008 Q1340* probably null Het
Elmo1 T C 13: 20,274,621 probably benign Het
Fbxw15 A C 9: 109,555,599 F378V possibly damaging Het
Fsip2 G A 2: 82,981,109 G2591R probably damaging Het
Gps2 C A 11: 69,915,354 D148E probably benign Het
Iars2 T C 1: 185,291,418 D772G possibly damaging Het
Ifit1 T A 19: 34,647,638 L58Q probably benign Het
Kctd4 A T 14: 75,962,926 Q112H probably benign Het
Letm1 A G 5: 33,762,505 L230P probably damaging Het
Lrch4 G T 5: 137,639,863 E136* probably null Het
Macc1 T C 12: 119,443,526 probably benign Het
Macrod1 T C 19: 7,057,126 L79P probably benign Het
Map2 T A 1: 66,414,622 N890K probably damaging Het
Mctp1 G A 13: 76,641,803 S270N probably benign Het
Mrpl44 C T 1: 79,777,991 R105C probably damaging Het
Mtg1 T A 7: 140,137,775 probably null Het
Mtg1 T C 7: 140,140,223 F68L probably benign Het
Nfil3 A G 13: 52,968,011 S286P possibly damaging Het
Nutm1 A G 2: 112,251,322 V332A possibly damaging Het
Obscn T A 11: 59,135,966 Q137L probably benign Het
Pcnx2 T G 8: 125,818,786 E1162A probably damaging Het
Pgr A G 9: 8,900,817 D117G possibly damaging Het
Plce1 T C 19: 38,524,901 C215R probably benign Het
Rrm1 T G 7: 102,460,351 Y461D probably damaging Het
Sbk3 C T 7: 4,969,992 V60I possibly damaging Het
Scube1 G T 15: 83,610,270 A852E possibly damaging Het
Sec24d T A 3: 123,343,892 I561N probably damaging Het
Slc16a4 T C 3: 107,311,585 *501Q probably null Het
Slc6a19 C A 13: 73,700,621 V5L probably benign Het
Spryd3 A G 15: 102,133,485 I34T possibly damaging Het
Syne1 A G 10: 5,316,040 L2191P probably damaging Het
Tbrg1 A G 9: 37,652,659 C227R probably damaging Het
Tdrd6 A G 17: 43,625,019 S1713P probably benign Het
Thap12 C T 7: 98,707,076 L57F probably benign Het
Top1 G A 2: 160,717,440 V628I probably damaging Het
Trim67 A G 8: 124,820,335 M495V probably null Het
Trio A C 15: 27,743,951 probably benign Het
Vmn2r23 A T 6: 123,703,032 Y71F Het
Ywhah A G 5: 33,027,191 N246S probably benign Het
Other mutations in Zcwpw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Zcwpw1 APN 5 137796799 missense probably benign 0.42
IGL02316:Zcwpw1 APN 5 137810010 unclassified probably benign
IGL02336:Zcwpw1 APN 5 137810114 missense probably damaging 0.96
R0103:Zcwpw1 UTSW 5 137810113 nonsense probably null
R0103:Zcwpw1 UTSW 5 137810113 nonsense probably null
R0295:Zcwpw1 UTSW 5 137817472 missense probably damaging 1.00
R0514:Zcwpw1 UTSW 5 137796683 missense probably benign 0.26
R0685:Zcwpw1 UTSW 5 137799592 missense probably benign 0.00
R0698:Zcwpw1 UTSW 5 137817521 missense probably benign
R0727:Zcwpw1 UTSW 5 137810807 unclassified probably benign
R1677:Zcwpw1 UTSW 5 137796760 missense probably damaging 0.99
R1780:Zcwpw1 UTSW 5 137796652 missense probably damaging 0.98
R1938:Zcwpw1 UTSW 5 137811622 missense probably damaging 0.99
R2875:Zcwpw1 UTSW 5 137810042 missense probably damaging 1.00
R4177:Zcwpw1 UTSW 5 137800133 missense probably damaging 0.99
R5073:Zcwpw1 UTSW 5 137795519 start codon destroyed probably null 0.81
R5913:Zcwpw1 UTSW 5 137800007 missense probably benign 0.31
R6224:Zcwpw1 UTSW 5 137812036 missense possibly damaging 0.63
R6542:Zcwpw1 UTSW 5 137812020 missense probably damaging 0.98
R7204:Zcwpw1 UTSW 5 137812084 missense probably damaging 0.98
R7542:Zcwpw1 UTSW 5 137819523 missense probably benign 0.00
R7600:Zcwpw1 UTSW 5 137800134 nonsense probably null
R7911:Zcwpw1 UTSW 5 137796770 missense probably null 1.00
R7972:Zcwpw1 UTSW 5 137801061 missense probably benign 0.13
R7988:Zcwpw1 UTSW 5 137817491 missense possibly damaging 0.69
R8174:Zcwpw1 UTSW 5 137819577 critical splice donor site probably null
R8851:Zcwpw1 UTSW 5 137822364 missense probably damaging 1.00
R9016:Zcwpw1 UTSW 5 137800078 missense probably damaging 0.98
R9131:Zcwpw1 UTSW 5 137810920 missense probably damaging 1.00
R9337:Zcwpw1 UTSW 5 137801012 missense probably benign 0.37
X0021:Zcwpw1 UTSW 5 137811607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCTATTCTATGACAAGATGCCAG -3'
(R):5'- TTTCCTTCCCAACTCAAAGAGGC -3'

Sequencing Primer
(F):5'- GACAAGATGCCAGAAGTAGTCTCTTC -3'
(R):5'- AGAGGCATCTTCCCTGAGCTAAG -3'
Posted On 2021-04-30