Incidental Mutation 'R8713:Vmn2r23'
ID669705
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Namevomeronasal 2, receptor 23
SynonymsEG435916
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R8713 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location123702821-123742291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123703032 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 71 (Y71F)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: Y71F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Adam18 T A 8: 24,652,173 M196L probably benign Het
Ankrd10 A G 8: 11,628,491 S134P probably damaging Het
Ano8 C T 8: 71,485,077 G47D probably damaging Het
Arl6ip4 T C 5: 124,116,762 V4A unknown Het
Cabp4 C T 19: 4,136,160 M247I probably benign Het
Ccdc30 A T 4: 119,404,207 L11Q probably damaging Het
Cdkl4 A G 17: 80,533,863 S288P possibly damaging Het
Celsr3 A G 9: 108,829,863 I1182V probably benign Het
Dnah17 T C 11: 118,088,202 D1788G probably damaging Het
Dsp A G 13: 38,168,725 D193G probably damaging Het
Dym T G 18: 75,056,738 Y132* probably null Het
Dync2h1 G A 9: 7,141,008 Q1340* probably null Het
Elmo1 T C 13: 20,274,621 probably benign Het
Fbxw15 A C 9: 109,555,599 F378V possibly damaging Het
Fsip2 G A 2: 82,981,109 G2591R probably damaging Het
Gps2 C A 11: 69,915,354 D148E probably benign Het
Iars2 T C 1: 185,291,418 D772G possibly damaging Het
Ifit1 T A 19: 34,647,638 L58Q probably benign Het
Kctd4 A T 14: 75,962,926 Q112H probably benign Het
Letm1 A G 5: 33,762,505 L230P probably damaging Het
Lrch4 G T 5: 137,639,863 E136* probably null Het
Macc1 T C 12: 119,443,526 probably benign Het
Macrod1 T C 19: 7,057,126 L79P probably benign Het
Map2 T A 1: 66,414,622 N890K probably damaging Het
Mctp1 G A 13: 76,641,803 S270N probably benign Het
Mrpl44 C T 1: 79,777,991 R105C probably damaging Het
Mtg1 T A 7: 140,137,775 probably null Het
Mtg1 T C 7: 140,140,223 F68L probably benign Het
Nfil3 A G 13: 52,968,011 S286P possibly damaging Het
Nutm1 A G 2: 112,251,322 V332A possibly damaging Het
Obscn T A 11: 59,135,966 Q137L probably benign Het
Pcnx2 T G 8: 125,818,786 E1162A probably damaging Het
Pgr A G 9: 8,900,817 D117G possibly damaging Het
Plce1 T C 19: 38,524,901 C215R probably benign Het
Rrm1 T G 7: 102,460,351 Y461D probably damaging Het
Sbk3 C T 7: 4,969,992 V60I possibly damaging Het
Scube1 G T 15: 83,610,270 A852E possibly damaging Het
Sec24d T A 3: 123,343,892 I561N probably damaging Het
Slc16a4 T C 3: 107,311,585 *501Q probably null Het
Slc6a19 C A 13: 73,700,621 V5L probably benign Het
Spryd3 A G 15: 102,133,485 I34T possibly damaging Het
Syne1 A G 10: 5,316,040 L2191P probably damaging Het
Tbrg1 A G 9: 37,652,659 C227R probably damaging Het
Tdrd6 A G 17: 43,625,019 S1713P probably benign Het
Thap12 C T 7: 98,707,076 L57F probably benign Het
Top1 G A 2: 160,717,440 V628I probably damaging Het
Trim67 A G 8: 124,820,335 M495V probably null Het
Trio A C 15: 27,743,951 probably benign Het
Ywhah A G 5: 33,027,191 N246S probably benign Het
Zcwpw1 T C 5: 137,799,532 I125T probably benign Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123704541 missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123741353 missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123704640 missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123741656 missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123713472 missense probably damaging 0.99
R8966:Vmn2r23 UTSW 6 123742120 missense possibly damaging 0.94
RF018:Vmn2r23 UTSW 6 123713116 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGCCCAAGAATCTTAACAGATCTCT -3'
(R):5'- CAGTGTTTAAACTCAGTACAATACACT -3'

Sequencing Primer
(F):5'- ACTTATTGCTTTCTCTCTTCTGATTG -3'
(R):5'- AGTAGCTTGTCCAGACTCCAG -3'
Posted On2021-04-30