Incidental Mutation 'R8713:Mtg1'
ID 669710
Institutional Source Beutler Lab
Gene Symbol Mtg1
Ensembl Gene ENSMUSG00000039018
Gene Name mitochondrial ribosome-associated GTPase 1
Synonyms Gtpbp7, LOC212508
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8713 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 140137564-140150786 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140140223 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 68 (F68L)
Ref Sequence ENSEMBL: ENSMUSP00000036491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026537] [ENSMUST00000036977] [ENSMUST00000124253]
AlphaFold Q8R2R6
Predicted Effect probably benign
Transcript: ENSMUST00000026537
SMART Domains Protein: ENSMUSP00000026537
Gene: ENSMUSG00000025464

DomainStartEndE-ValueType
Pfam:NAD_binding_8 10 79 4.1e-14 PFAM
Pfam:Amino_oxidase 15 490 4.9e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036977
AA Change: F68L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000036491
Gene: ENSMUSG00000039018
AA Change: F68L

DomainStartEndE-ValueType
SCOP:d1egaa1 31 129 5e-6 SMART
Pfam:FeoB_N 143 219 3.9e-6 PFAM
Pfam:MMR_HSR1 144 283 2.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124253
AA Change: F28L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000211171
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Adam18 T A 8: 24,652,173 M196L probably benign Het
Ankrd10 A G 8: 11,628,491 S134P probably damaging Het
Ano8 C T 8: 71,485,077 G47D probably damaging Het
Arl6ip4 T C 5: 124,116,762 V4A unknown Het
Cabp4 C T 19: 4,136,160 M247I probably benign Het
Ccdc30 A T 4: 119,404,207 L11Q probably damaging Het
Cdkl4 A G 17: 80,533,863 S288P possibly damaging Het
Celsr3 A G 9: 108,829,863 I1182V probably benign Het
Dnah17 T C 11: 118,088,202 D1788G probably damaging Het
Dsp A G 13: 38,168,725 D193G probably damaging Het
Dym T G 18: 75,056,738 Y132* probably null Het
Dync2h1 G A 9: 7,141,008 Q1340* probably null Het
Elmo1 T C 13: 20,274,621 probably benign Het
Fbxw15 A C 9: 109,555,599 F378V possibly damaging Het
Fsip2 G A 2: 82,981,109 G2591R probably damaging Het
Gps2 C A 11: 69,915,354 D148E probably benign Het
Iars2 T C 1: 185,291,418 D772G possibly damaging Het
Ifit1 T A 19: 34,647,638 L58Q probably benign Het
Kctd4 A T 14: 75,962,926 Q112H probably benign Het
Letm1 A G 5: 33,762,505 L230P probably damaging Het
Lrch4 G T 5: 137,639,863 E136* probably null Het
Macc1 T C 12: 119,443,526 probably benign Het
Macrod1 T C 19: 7,057,126 L79P probably benign Het
Map2 T A 1: 66,414,622 N890K probably damaging Het
Mctp1 G A 13: 76,641,803 S270N probably benign Het
Mrpl44 C T 1: 79,777,991 R105C probably damaging Het
Nfil3 A G 13: 52,968,011 S286P possibly damaging Het
Nutm1 A G 2: 112,251,322 V332A possibly damaging Het
Obscn T A 11: 59,135,966 Q137L probably benign Het
Pcnx2 T G 8: 125,818,786 E1162A probably damaging Het
Pgr A G 9: 8,900,817 D117G possibly damaging Het
Plce1 T C 19: 38,524,901 C215R probably benign Het
Rrm1 T G 7: 102,460,351 Y461D probably damaging Het
Sbk3 C T 7: 4,969,992 V60I possibly damaging Het
Scube1 G T 15: 83,610,270 A852E possibly damaging Het
Sec24d T A 3: 123,343,892 I561N probably damaging Het
Slc16a4 T C 3: 107,311,585 *501Q probably null Het
Slc6a19 C A 13: 73,700,621 V5L probably benign Het
Spryd3 A G 15: 102,133,485 I34T possibly damaging Het
Syne1 A G 10: 5,316,040 L2191P probably damaging Het
Tbrg1 A G 9: 37,652,659 C227R probably damaging Het
Tdrd6 A G 17: 43,625,019 S1713P probably benign Het
Thap12 C T 7: 98,707,076 L57F probably benign Het
Top1 G A 2: 160,717,440 V628I probably damaging Het
Trim67 A G 8: 124,820,335 M495V probably null Het
Trio A C 15: 27,743,951 probably benign Het
Vmn2r23 A T 6: 123,703,032 Y71F Het
Ywhah A G 5: 33,027,191 N246S probably benign Het
Zcwpw1 T C 5: 137,799,532 I125T probably benign Het
Other mutations in Mtg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Mtg1 APN 7 140150236 missense probably benign 0.00
IGL02105:Mtg1 APN 7 140150206 missense probably damaging 1.00
IGL02458:Mtg1 APN 7 140150172 missense probably benign 0.01
IGL02682:Mtg1 APN 7 140144729 splice site probably benign
R0666:Mtg1 UTSW 7 140144344 missense probably benign
R0893:Mtg1 UTSW 7 140149752 missense probably damaging 1.00
R3707:Mtg1 UTSW 7 140149804 missense probably damaging 0.99
R4993:Mtg1 UTSW 7 140140283 missense probably null 1.00
R5810:Mtg1 UTSW 7 140145985 splice site probably null
R5886:Mtg1 UTSW 7 140149865 splice site probably null
R5960:Mtg1 UTSW 7 140146993 unclassified probably benign
R7069:Mtg1 UTSW 7 140143744 missense probably benign 0.00
R7110:Mtg1 UTSW 7 140146866 missense probably benign 0.02
R7492:Mtg1 UTSW 7 140144697 missense probably damaging 1.00
R7790:Mtg1 UTSW 7 140149749 missense probably damaging 1.00
R7917:Mtg1 UTSW 7 140147265 missense probably damaging 1.00
R8155:Mtg1 UTSW 7 140144709 missense probably benign 0.07
R8444:Mtg1 UTSW 7 140138370 missense probably damaging 1.00
R8713:Mtg1 UTSW 7 140137775 critical splice donor site probably null
R9424:Mtg1 UTSW 7 140147299 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCTTGAGAAGTTAGGTGACAG -3'
(R):5'- TTTAAGTTACAGCCTCCCCGG -3'

Sequencing Primer
(F):5'- AGAAGTTAGGTGACAGTCCCTTCC -3'
(R):5'- GGGGCATCACAGAACTCCTC -3'
Posted On 2021-04-30