Incidental Mutation 'R8713:Ankrd10'
ID 669711
Institutional Source Beutler Lab
Gene Symbol Ankrd10
Ensembl Gene ENSMUSG00000031508
Gene Name ankyrin repeat domain 10
Synonyms 4833425P12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R8713 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 11611583-11635757 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11628491 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 134 (S134P)
Ref Sequence ENSEMBL: ENSMUSP00000033905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033905] [ENSMUST00000169782] [ENSMUST00000209915] [ENSMUST00000210530] [ENSMUST00000210876] [ENSMUST00000211174]
AlphaFold Q99LW0
Predicted Effect probably damaging
Transcript: ENSMUST00000033905
AA Change: S134P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033905
Gene: ENSMUSG00000031508
AA Change: S134P

DomainStartEndE-ValueType
Blast:ANK 20 49 2e-10 BLAST
ANK 56 85 2.66e-5 SMART
ANK 90 119 6.46e-4 SMART
ANK 123 152 1.03e-2 SMART
Blast:ANK 156 185 6e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000169782
AA Change: S134P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131657
Gene: ENSMUSG00000031508
AA Change: S134P

DomainStartEndE-ValueType
Blast:ANK 20 49 1e-10 BLAST
ANK 56 85 2.66e-5 SMART
ANK 90 119 6.46e-4 SMART
ANK 123 152 1.03e-2 SMART
Blast:ANK 156 185 4e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000209915
AA Change: S61P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000210530
AA Change: S134P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000210876
Predicted Effect probably damaging
Transcript: ENSMUST00000211174
AA Change: S134P

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Adam18 T A 8: 24,652,173 M196L probably benign Het
Ano8 C T 8: 71,485,077 G47D probably damaging Het
Arl6ip4 T C 5: 124,116,762 V4A unknown Het
Cabp4 C T 19: 4,136,160 M247I probably benign Het
Ccdc30 A T 4: 119,404,207 L11Q probably damaging Het
Cdkl4 A G 17: 80,533,863 S288P possibly damaging Het
Celsr3 A G 9: 108,829,863 I1182V probably benign Het
Dnah17 T C 11: 118,088,202 D1788G probably damaging Het
Dsp A G 13: 38,168,725 D193G probably damaging Het
Dym T G 18: 75,056,738 Y132* probably null Het
Dync2h1 G A 9: 7,141,008 Q1340* probably null Het
Elmo1 T C 13: 20,274,621 probably benign Het
Fbxw15 A C 9: 109,555,599 F378V possibly damaging Het
Fsip2 G A 2: 82,981,109 G2591R probably damaging Het
Gps2 C A 11: 69,915,354 D148E probably benign Het
Iars2 T C 1: 185,291,418 D772G possibly damaging Het
Ifit1 T A 19: 34,647,638 L58Q probably benign Het
Kctd4 A T 14: 75,962,926 Q112H probably benign Het
Letm1 A G 5: 33,762,505 L230P probably damaging Het
Lrch4 G T 5: 137,639,863 E136* probably null Het
Macc1 T C 12: 119,443,526 probably benign Het
Macrod1 T C 19: 7,057,126 L79P probably benign Het
Map2 T A 1: 66,414,622 N890K probably damaging Het
Mctp1 G A 13: 76,641,803 S270N probably benign Het
Mrpl44 C T 1: 79,777,991 R105C probably damaging Het
Mtg1 T A 7: 140,137,775 probably null Het
Mtg1 T C 7: 140,140,223 F68L probably benign Het
Nfil3 A G 13: 52,968,011 S286P possibly damaging Het
Nutm1 A G 2: 112,251,322 V332A possibly damaging Het
Obscn T A 11: 59,135,966 Q137L probably benign Het
Pcnx2 T G 8: 125,818,786 E1162A probably damaging Het
Pgr A G 9: 8,900,817 D117G possibly damaging Het
Plce1 T C 19: 38,524,901 C215R probably benign Het
Rrm1 T G 7: 102,460,351 Y461D probably damaging Het
Sbk3 C T 7: 4,969,992 V60I possibly damaging Het
Scube1 G T 15: 83,610,270 A852E possibly damaging Het
Sec24d T A 3: 123,343,892 I561N probably damaging Het
Slc16a4 T C 3: 107,311,585 *501Q probably null Het
Slc6a19 C A 13: 73,700,621 V5L probably benign Het
Spryd3 A G 15: 102,133,485 I34T possibly damaging Het
Syne1 A G 10: 5,316,040 L2191P probably damaging Het
Tbrg1 A G 9: 37,652,659 C227R probably damaging Het
Tdrd6 A G 17: 43,625,019 S1713P probably benign Het
Thap12 C T 7: 98,707,076 L57F probably benign Het
Top1 G A 2: 160,717,440 V628I probably damaging Het
Trim67 A G 8: 124,820,335 M495V probably null Het
Trio A C 15: 27,743,951 probably benign Het
Vmn2r23 A T 6: 123,703,032 Y71F Het
Ywhah A G 5: 33,027,191 N246S probably benign Het
Zcwpw1 T C 5: 137,799,532 I125T probably benign Het
Other mutations in Ankrd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Ankrd10 APN 8 11635592 missense probably benign
IGL03029:Ankrd10 APN 8 11619304 splice site probably null
R0098:Ankrd10 UTSW 8 11612560 missense probably benign 0.01
R0393:Ankrd10 UTSW 8 11635482 missense possibly damaging 0.58
R2870:Ankrd10 UTSW 8 11615682 missense probably damaging 0.98
R2870:Ankrd10 UTSW 8 11615682 missense probably damaging 0.98
R4176:Ankrd10 UTSW 8 11612644 missense probably benign 0.00
R5985:Ankrd10 UTSW 8 11619077 nonsense probably null
R6999:Ankrd10 UTSW 8 11619106 missense probably damaging 1.00
R7108:Ankrd10 UTSW 8 11612624 missense probably damaging 1.00
R7322:Ankrd10 UTSW 8 11615841 missense probably damaging 0.97
R7522:Ankrd10 UTSW 8 11632910 missense probably damaging 1.00
R7559:Ankrd10 UTSW 8 11612548 missense probably damaging 0.97
R7629:Ankrd10 UTSW 8 11615769 missense probably benign 0.13
R8263:Ankrd10 UTSW 8 11615707 missense probably benign 0.22
R8493:Ankrd10 UTSW 8 11628518 nonsense probably null
R8897:Ankrd10 UTSW 8 11615788 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AGGCACAACTCTACTGCTAATTTC -3'
(R):5'- GCAGAATGTTGTGGGCAGTC -3'

Sequencing Primer
(F):5'- CTTGTAAGGCTTTTGCTGC -3'
(R):5'- AGTCTGCCCTGTTGCCTGG -3'
Posted On 2021-04-30