Incidental Mutation 'R8713:Ano8'
ID 669713
Institutional Source Beutler Lab
Gene Symbol Ano8
Ensembl Gene ENSMUSG00000034863
Gene Name anoctamin 8
Synonyms Tmem16h
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8713 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 71476019-71485963 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 71485077 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 47 (G47D)
Ref Sequence ENSEMBL: ENSMUSP00000149365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007754] [ENSMUST00000093450] [ENSMUST00000095259] [ENSMUST00000127741] [ENSMUST00000150969] [ENSMUST00000168847] [ENSMUST00000213382]
AlphaFold Q6PB70
Predicted Effect probably benign
Transcript: ENSMUST00000007754
SMART Domains Protein: ENSMUSP00000007754
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093450
AA Change: G47D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091157
Gene: ENSMUSG00000034863
AA Change: G47D

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
Pfam:Anoctamin 237 874 3e-149 PFAM
coiled coil region 881 919 N/A INTRINSIC
low complexity region 948 964 N/A INTRINSIC
low complexity region 974 988 N/A INTRINSIC
low complexity region 1042 1056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095259
SMART Domains Protein: ENSMUSP00000092892
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 4.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124349
Predicted Effect probably benign
Transcript: ENSMUST00000127741
SMART Domains Protein: ENSMUSP00000123082
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 2.2e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146551
Predicted Effect probably benign
Transcript: ENSMUST00000150969
SMART Domains Protein: ENSMUSP00000114193
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168847
SMART Domains Protein: ENSMUSP00000126761
Gene: ENSMUSG00000007610

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 153 3e-35 PFAM
Pfam:MnmE_helical 156 490 2e-48 PFAM
Pfam:FeoB_N 251 390 1.5e-7 PFAM
Pfam:MMR_HSR1 252 376 1.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213016
Predicted Effect probably damaging
Transcript: ENSMUST00000213382
AA Change: G47D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1162 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Adam18 T A 8: 24,652,173 M196L probably benign Het
Ankrd10 A G 8: 11,628,491 S134P probably damaging Het
Arl6ip4 T C 5: 124,116,762 V4A unknown Het
Cabp4 C T 19: 4,136,160 M247I probably benign Het
Ccdc30 A T 4: 119,404,207 L11Q probably damaging Het
Cdkl4 A G 17: 80,533,863 S288P possibly damaging Het
Celsr3 A G 9: 108,829,863 I1182V probably benign Het
Dnah17 T C 11: 118,088,202 D1788G probably damaging Het
Dsp A G 13: 38,168,725 D193G probably damaging Het
Dym T G 18: 75,056,738 Y132* probably null Het
Dync2h1 G A 9: 7,141,008 Q1340* probably null Het
Elmo1 T C 13: 20,274,621 probably benign Het
Fbxw15 A C 9: 109,555,599 F378V possibly damaging Het
Fsip2 G A 2: 82,981,109 G2591R probably damaging Het
Gps2 C A 11: 69,915,354 D148E probably benign Het
Iars2 T C 1: 185,291,418 D772G possibly damaging Het
Ifit1 T A 19: 34,647,638 L58Q probably benign Het
Kctd4 A T 14: 75,962,926 Q112H probably benign Het
Letm1 A G 5: 33,762,505 L230P probably damaging Het
Lrch4 G T 5: 137,639,863 E136* probably null Het
Macc1 T C 12: 119,443,526 probably benign Het
Macrod1 T C 19: 7,057,126 L79P probably benign Het
Map2 T A 1: 66,414,622 N890K probably damaging Het
Mctp1 G A 13: 76,641,803 S270N probably benign Het
Mrpl44 C T 1: 79,777,991 R105C probably damaging Het
Mtg1 T A 7: 140,137,775 probably null Het
Mtg1 T C 7: 140,140,223 F68L probably benign Het
Nfil3 A G 13: 52,968,011 S286P possibly damaging Het
Nutm1 A G 2: 112,251,322 V332A possibly damaging Het
Obscn T A 11: 59,135,966 Q137L probably benign Het
Pcnx2 T G 8: 125,818,786 E1162A probably damaging Het
Pgr A G 9: 8,900,817 D117G possibly damaging Het
Plce1 T C 19: 38,524,901 C215R probably benign Het
Rrm1 T G 7: 102,460,351 Y461D probably damaging Het
Sbk3 C T 7: 4,969,992 V60I possibly damaging Het
Scube1 G T 15: 83,610,270 A852E possibly damaging Het
Sec24d T A 3: 123,343,892 I561N probably damaging Het
Slc16a4 T C 3: 107,311,585 *501Q probably null Het
Slc6a19 C A 13: 73,700,621 V5L probably benign Het
Spryd3 A G 15: 102,133,485 I34T possibly damaging Het
Syne1 A G 10: 5,316,040 L2191P probably damaging Het
Tbrg1 A G 9: 37,652,659 C227R probably damaging Het
Tdrd6 A G 17: 43,625,019 S1713P probably benign Het
Thap12 C T 7: 98,707,076 L57F probably benign Het
Top1 G A 2: 160,717,440 V628I probably damaging Het
Trim67 A G 8: 124,820,335 M495V probably null Het
Trio A C 15: 27,743,951 probably benign Het
Vmn2r23 A T 6: 123,703,032 Y71F Het
Ywhah A G 5: 33,027,191 N246S probably benign Het
Zcwpw1 T C 5: 137,799,532 I125T probably benign Het
Other mutations in Ano8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ano8 APN 8 71484258 splice site probably benign
IGL00501:Ano8 APN 8 71479149 critical splice donor site probably null
IGL01380:Ano8 APN 8 71480809 unclassified probably benign
IGL02138:Ano8 APN 8 71484842 missense probably damaging 0.99
IGL02516:Ano8 APN 8 71485077 missense probably damaging 1.00
IGL02675:Ano8 APN 8 71483540 missense probably damaging 0.99
IGL02995:Ano8 APN 8 71483117 missense possibly damaging 0.72
H8786:Ano8 UTSW 8 71478744 unclassified probably benign
R0265:Ano8 UTSW 8 71480524 unclassified probably benign
R0282:Ano8 UTSW 8 71480614 unclassified probably benign
R0518:Ano8 UTSW 8 71479258 missense probably benign 0.39
R0521:Ano8 UTSW 8 71479258 missense probably benign 0.39
R1028:Ano8 UTSW 8 71480971 small deletion probably benign
R1147:Ano8 UTSW 8 71482017 missense probably damaging 1.00
R1147:Ano8 UTSW 8 71482017 missense probably damaging 1.00
R1748:Ano8 UTSW 8 71478958 unclassified probably benign
R1852:Ano8 UTSW 8 71483487 missense probably damaging 0.99
R4161:Ano8 UTSW 8 71482637 missense probably damaging 1.00
R4192:Ano8 UTSW 8 71483292 missense probably damaging 1.00
R4274:Ano8 UTSW 8 71478741 unclassified probably benign
R4834:Ano8 UTSW 8 71484295 missense probably damaging 1.00
R4961:Ano8 UTSW 8 71482996 missense probably damaging 1.00
R5252:Ano8 UTSW 8 71482617 missense probably damaging 1.00
R5553:Ano8 UTSW 8 71484997 splice site probably null
R5598:Ano8 UTSW 8 71482577 missense probably damaging 1.00
R5695:Ano8 UTSW 8 71483243 missense probably damaging 0.98
R5994:Ano8 UTSW 8 71484834 missense probably damaging 1.00
R6019:Ano8 UTSW 8 71482380 missense probably damaging 1.00
R6153:Ano8 UTSW 8 71480797 unclassified probably benign
R6405:Ano8 UTSW 8 71483030 missense probably damaging 1.00
R6516:Ano8 UTSW 8 71481780 splice site probably null
R6539:Ano8 UTSW 8 71484483 missense probably damaging 1.00
R7194:Ano8 UTSW 8 71482363 missense possibly damaging 0.66
R7204:Ano8 UTSW 8 71479025 missense probably benign 0.39
R7340:Ano8 UTSW 8 71483011 missense probably damaging 0.99
R7365:Ano8 UTSW 8 71485110 missense probably damaging 1.00
R7417:Ano8 UTSW 8 71480833 missense unknown
R7486:Ano8 UTSW 8 71484998 critical splice donor site probably null
R7644:Ano8 UTSW 8 71484830 missense probably damaging 0.98
R7709:Ano8 UTSW 8 71482289 missense probably damaging 1.00
R7719:Ano8 UTSW 8 71483140 missense possibly damaging 0.82
R8040:Ano8 UTSW 8 71482168 missense probably benign 0.26
R8219:Ano8 UTSW 8 71480713 missense unknown
R8355:Ano8 UTSW 8 71480566 unclassified probably benign
R8401:Ano8 UTSW 8 71483367 missense probably damaging 1.00
R8755:Ano8 UTSW 8 71483080 missense probably benign 0.11
R8871:Ano8 UTSW 8 71479300 missense probably benign 0.39
R8903:Ano8 UTSW 8 71482190 critical splice acceptor site probably null
R8990:Ano8 UTSW 8 71476557 missense unknown
R9037:Ano8 UTSW 8 71484444 missense probably damaging 1.00
R9379:Ano8 UTSW 8 71483534 missense probably benign 0.28
R9432:Ano8 UTSW 8 71480917 missense unknown
X0026:Ano8 UTSW 8 71479157 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATCAGTGGTGTCTGCCAAGG -3'
(R):5'- CATGAGTAAGATTCTTAAGGCAGG -3'

Sequencing Primer
(F):5'- CATAGGGGCCAATGGGTC -3'
(R):5'- GACCTAGGGGGAAGGGCC -3'
Posted On 2021-04-30