Incidental Mutation 'R8713:Trim67'
ID669715
Institutional Source Beutler Lab
Gene Symbol Trim67
Ensembl Gene ENSMUSG00000036913
Gene Nametripartite motif-containing 67
SynonymsD130049O21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R8713 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location124793092-124834713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124820335 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 495 (M495V)
Ref Sequence ENSEMBL: ENSMUSP00000040601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041106] [ENSMUST00000167588] [ENSMUST00000211867]
Predicted Effect probably null
Transcript: ENSMUST00000041106
AA Change: M495V

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000040601
Gene: ENSMUSG00000036913
AA Change: M495V

DomainStartEndE-ValueType
RING 7 157 1.41e-4 SMART
BBOX 198 248 4.65e-5 SMART
BBOX 285 327 3.04e-9 SMART
BBC 334 460 1.18e-28 SMART
FN3 498 579 1.75e-6 SMART
Pfam:SPRY 635 755 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167588
AA Change: M495V

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130343
Gene: ENSMUSG00000036913
AA Change: M495V

DomainStartEndE-ValueType
RING 7 157 1.41e-4 SMART
BBOX 198 248 4.65e-5 SMART
BBOX 285 327 3.04e-9 SMART
BBC 334 460 1.18e-28 SMART
FN3 498 579 1.75e-6 SMART
Pfam:SPRY 633 756 3.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211867
AA Change: M495V

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Adam18 T A 8: 24,652,173 M196L probably benign Het
Ankrd10 A G 8: 11,628,491 S134P probably damaging Het
Ano8 C T 8: 71,485,077 G47D probably damaging Het
Arl6ip4 T C 5: 124,116,762 V4A unknown Het
Cabp4 C T 19: 4,136,160 M247I probably benign Het
Ccdc30 A T 4: 119,404,207 L11Q probably damaging Het
Cdkl4 A G 17: 80,533,863 S288P possibly damaging Het
Celsr3 A G 9: 108,829,863 I1182V probably benign Het
Dnah17 T C 11: 118,088,202 D1788G probably damaging Het
Dsp A G 13: 38,168,725 D193G probably damaging Het
Dym T G 18: 75,056,738 Y132* probably null Het
Dync2h1 G A 9: 7,141,008 Q1340* probably null Het
Elmo1 T C 13: 20,274,621 probably benign Het
Fbxw15 A C 9: 109,555,599 F378V possibly damaging Het
Fsip2 G A 2: 82,981,109 G2591R probably damaging Het
Gps2 C A 11: 69,915,354 D148E probably benign Het
Iars2 T C 1: 185,291,418 D772G possibly damaging Het
Ifit1 T A 19: 34,647,638 L58Q probably benign Het
Kctd4 A T 14: 75,962,926 Q112H probably benign Het
Letm1 A G 5: 33,762,505 L230P probably damaging Het
Lrch4 G T 5: 137,639,863 E136* probably null Het
Macc1 T C 12: 119,443,526 probably benign Het
Macrod1 T C 19: 7,057,126 L79P probably benign Het
Map2 T A 1: 66,414,622 N890K probably damaging Het
Mctp1 G A 13: 76,641,803 S270N probably benign Het
Mrpl44 C T 1: 79,777,991 R105C probably damaging Het
Mtg1 T A 7: 140,137,775 probably null Het
Mtg1 T C 7: 140,140,223 F68L probably benign Het
Nfil3 A G 13: 52,968,011 S286P possibly damaging Het
Nutm1 A G 2: 112,251,322 V332A possibly damaging Het
Obscn T A 11: 59,135,966 Q137L probably benign Het
Pcnx2 T G 8: 125,818,786 E1162A probably damaging Het
Pgr A G 9: 8,900,817 D117G possibly damaging Het
Plce1 T C 19: 38,524,901 C215R probably benign Het
Rrm1 T G 7: 102,460,351 Y461D probably damaging Het
Sbk3 C T 7: 4,969,992 V60I possibly damaging Het
Scube1 G T 15: 83,610,270 A852E possibly damaging Het
Sec24d T A 3: 123,343,892 I561N probably damaging Het
Slc16a4 T C 3: 107,311,585 *501Q probably null Het
Slc6a19 C A 13: 73,700,621 V5L probably benign Het
Spryd3 A G 15: 102,133,485 I34T possibly damaging Het
Syne1 A G 10: 5,316,040 L2191P probably damaging Het
Tbrg1 A G 9: 37,652,659 C227R probably damaging Het
Tdrd6 A G 17: 43,625,019 S1713P probably benign Het
Thap12 C T 7: 98,707,076 L57F probably benign Het
Top1 G A 2: 160,717,440 V628I probably damaging Het
Trio A C 15: 27,743,951 probably benign Het
Vmn2r23 A T 6: 123,703,032 Y71F Het
Ywhah A G 5: 33,027,191 N246S probably benign Het
Zc3h18 TGAGGAGGAGGAGGAG TGAGGAGGAGGAG 8: 122,383,857 probably benign Het
Zcwpw1 T C 5: 137,799,532 I125T probably benign Het
Other mutations in Trim67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Trim67 APN 8 124815060 splice site probably benign
IGL01676:Trim67 APN 8 124815160 missense possibly damaging 0.51
IGL01779:Trim67 APN 8 124828121 missense probably damaging 1.00
IGL02057:Trim67 APN 8 124823130 missense probably benign 0.00
IGL02201:Trim67 APN 8 124794058 missense probably benign 0.26
IGL02304:Trim67 APN 8 124825952 missense probably damaging 1.00
R0068:Trim67 UTSW 8 124794568 missense probably damaging 0.97
R0241:Trim67 UTSW 8 124823190 missense probably damaging 0.99
R0319:Trim67 UTSW 8 124823227 missense probably damaging 0.98
R0471:Trim67 UTSW 8 124794658 missense probably benign 0.01
R1171:Trim67 UTSW 8 124829081 missense probably damaging 0.97
R1175:Trim67 UTSW 8 124817035 missense probably damaging 0.99
R1444:Trim67 UTSW 8 124823193 missense probably benign 0.01
R1596:Trim67 UTSW 8 124826139 missense probably damaging 0.97
R1706:Trim67 UTSW 8 124794421 missense probably damaging 1.00
R4951:Trim67 UTSW 8 124794667 missense probably benign
R5200:Trim67 UTSW 8 124824850 missense probably damaging 0.99
R5787:Trim67 UTSW 8 124794312 nonsense probably null
R6023:Trim67 UTSW 8 124815104 missense probably damaging 0.99
R6290:Trim67 UTSW 8 124823179 missense probably benign 0.00
R6536:Trim67 UTSW 8 124794342 missense possibly damaging 0.51
R7315:Trim67 UTSW 8 124794330 missense probably benign 0.18
R7660:Trim67 UTSW 8 124820285 missense probably damaging 1.00
R8432:Trim67 UTSW 8 124794062 small deletion probably benign
R8446:Trim67 UTSW 8 124793991 missense probably damaging 0.99
R8897:Trim67 UTSW 8 124825979 missense probably benign
Z1088:Trim67 UTSW 8 124817041 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGCTGGCAGCTCTTCATC -3'
(R):5'- CCTTGGGTCTTTGAAAGGCAG -3'

Sequencing Primer
(F):5'- TGCAGACCCAACCCTTCTG -3'
(R):5'- GTCTTTGAAAGGCAGCTCAAGTTC -3'
Posted On2021-04-30