Mutagenetix > Incidental Mutations

Incidental Mutation 'R8713:Pcnx2'

669716

Institutional Source

Beutler Lab

Gene Symbol

Pcnx2

Ensembl Gene

ENSMUSG00000060212

Gene Name

pecanex homolog 2

Synonyms

Pcnxl2, E330039K12Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8713 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125751508-125898317 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 125818786 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 1162 (E1162A)

Ref Sequence

ENSEMBL: ENSMUSP00000042294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047239]

AlphaFold

Q5DU28

Predicted Effect

probably damaging
Transcript: ENSMUST00000047239
AA Change: E1162A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212
AA Change: E1162A

Domain	Start	End	E-Value	Type
transmembrane domain	36	53	N/A	INTRINSIC
transmembrane domain	60	82	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
low complexity region	391	415	N/A	INTRINSIC
low complexity region	457	476	N/A	INTRINSIC
low complexity region	727	742	N/A	INTRINSIC
low complexity region	806	817	N/A	INTRINSIC
transmembrane domain	823	842	N/A	INTRINSIC
transmembrane domain	849	866	N/A	INTRINSIC
transmembrane domain	881	902	N/A	INTRINSIC
transmembrane domain	934	956	N/A	INTRINSIC
transmembrane domain	976	998	N/A	INTRINSIC
transmembrane domain	1011	1030	N/A	INTRINSIC
transmembrane domain	1080	1102	N/A	INTRINSIC
transmembrane domain	1104	1126	N/A	INTRINSIC
Pfam:Pecanex_C	1603	1828	3.5e-113	PFAM
low complexity region	1864	1889	N/A	INTRINSIC
low complexity region	1968	1981	N/A	INTRINSIC
low complexity region	2004	2019	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim2	C	T	5: 35,873,174	A581V	possibly damaging	Het
Adam18	T	A	8: 24,652,173	M196L	probably benign	Het
Ankrd10	A	G	8: 11,628,491	S134P	probably damaging	Het
Ano8	C	T	8: 71,485,077	G47D	probably damaging	Het
Arl6ip4	T	C	5: 124,116,762	V4A	unknown	Het
Cabp4	C	T	19: 4,136,160	M247I	probably benign	Het
Ccdc30	A	T	4: 119,404,207	L11Q	probably damaging	Het
Cdkl4	A	G	17: 80,533,863	S288P	possibly damaging	Het
Celsr3	A	G	9: 108,829,863	I1182V	probably benign	Het
Dnah17	T	C	11: 118,088,202	D1788G	probably damaging	Het
Dsp	A	G	13: 38,168,725	D193G	probably damaging	Het
Dym	T	G	18: 75,056,738	Y132*	probably null	Het
Dync2h1	G	A	9: 7,141,008	Q1340*	probably null	Het
Elmo1	T	C	13: 20,274,621		probably benign	Het
Fbxw15	A	C	9: 109,555,599	F378V	possibly damaging	Het
Fsip2	G	A	2: 82,981,109	G2591R	probably damaging	Het
Gps2	C	A	11: 69,915,354	D148E	probably benign	Het
Iars2	T	C	1: 185,291,418	D772G	possibly damaging	Het
Ifit1	T	A	19: 34,647,638	L58Q	probably benign	Het
Kctd4	A	T	14: 75,962,926	Q112H	probably benign	Het
Letm1	A	G	5: 33,762,505	L230P	probably damaging	Het
Lrch4	G	T	5: 137,639,863	E136*	probably null	Het
Macc1	T	C	12: 119,443,526		probably benign	Het
Macrod1	T	C	19: 7,057,126	L79P	probably benign	Het
Map2	T	A	1: 66,414,622	N890K	probably damaging	Het
Mctp1	G	A	13: 76,641,803	S270N	probably benign	Het
Mrpl44	C	T	1: 79,777,991	R105C	probably damaging	Het
Mtg1	T	A	7: 140,137,775		probably null	Het
Mtg1	T	C	7: 140,140,223	F68L	probably benign	Het
Nfil3	A	G	13: 52,968,011	S286P	possibly damaging	Het
Nutm1	A	G	2: 112,251,322	V332A	possibly damaging	Het
Obscn	T	A	11: 59,135,966	Q137L	probably benign	Het
Pgr	A	G	9: 8,900,817	D117G	possibly damaging	Het
Plce1	T	C	19: 38,524,901	C215R	probably benign	Het
Rrm1	T	G	7: 102,460,351	Y461D	probably damaging	Het
Sbk3	C	T	7: 4,969,992	V60I	possibly damaging	Het
Scube1	G	T	15: 83,610,270	A852E	possibly damaging	Het
Sec24d	T	A	3: 123,343,892	I561N	probably damaging	Het
Slc16a4	T	C	3: 107,311,585	*501Q	probably null	Het
Slc6a19	C	A	13: 73,700,621	V5L	probably benign	Het
Spryd3	A	G	15: 102,133,485	I34T	possibly damaging	Het
Syne1	A	G	10: 5,316,040	L2191P	probably damaging	Het
Tbrg1	A	G	9: 37,652,659	C227R	probably damaging	Het
Tdrd6	A	G	17: 43,625,019	S1713P	probably benign	Het
Thap12	C	T	7: 98,707,076	L57F	probably benign	Het
Top1	G	A	2: 160,717,440	V628I	probably damaging	Het
Trim67	A	G	8: 124,820,335	M495V	probably null	Het
Trio	A	C	15: 27,743,951		probably benign	Het
Vmn2r23	A	T	6: 123,703,032	Y71F		Het
Ywhah	A	G	5: 33,027,191	N246S	probably benign	Het
Zcwpw1	T	C	5: 137,799,532	I125T	probably benign	Het

Other mutations in Pcnx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Pcnx2	APN	8	125887585	missense	probably damaging	1.00
IGL00900:Pcnx2	APN	8	125863236	splice site	probably benign
IGL01134:Pcnx2	APN	8	125863150	missense	probably benign
IGL01370:Pcnx2	APN	8	125801483	missense	probably damaging	0.96
IGL01452:Pcnx2	APN	8	125838032	missense	probably damaging	1.00
IGL01477:Pcnx2	APN	8	125785305	missense	probably damaging	1.00
IGL01610:Pcnx2	APN	8	125839633	missense	possibly damaging	0.67
IGL01640:Pcnx2	APN	8	125801558	missense	probably benign	0.14
IGL01645:Pcnx2	APN	8	125887917	missense	probably damaging	1.00
IGL01876:Pcnx2	APN	8	125866031	missense	probably benign	0.31
IGL01933:Pcnx2	APN	8	125761654	missense	probably damaging	1.00
IGL02208:Pcnx2	APN	8	125752155	missense	probably benign	0.30
IGL02573:Pcnx2	APN	8	125855273	missense	probably benign	0.34
IGL02810:Pcnx2	APN	8	125887203	missense	probably benign	0.03
IGL02859:Pcnx2	APN	8	125863173	missense	probably damaging	1.00
IGL02879:Pcnx2	APN	8	125772057	missense	probably damaging	1.00
IGL03202:Pcnx2	APN	8	125772044	missense	probably damaging	0.98
IGL03259:Pcnx2	APN	8	125753649	missense	probably benign	0.19
IGL03395:Pcnx2	APN	8	125887523	missense	probably benign	0.00
IGL03410:Pcnx2	APN	8	125887040	missense	probably damaging	1.00
gallen	UTSW	8	125891120	missense	probably damaging	1.00
hotzone	UTSW	8	125891141	missense	probably benign	0.00
R0107:Pcnx2	UTSW	8	125753586	missense	probably benign	0.29
R0477:Pcnx2	UTSW	8	125761567	missense	probably damaging	0.99
R0610:Pcnx2	UTSW	8	125839687	missense	probably damaging	1.00
R0645:Pcnx2	UTSW	8	125760720	missense	possibly damaging	0.64
R0894:Pcnx2	UTSW	8	125886926	splice site	probably benign
R1083:Pcnx2	UTSW	8	125772104	missense	probably damaging	1.00
R1199:Pcnx2	UTSW	8	125887314	missense	possibly damaging	0.60
R1296:Pcnx2	UTSW	8	125773833	missense	probably damaging	1.00
R1445:Pcnx2	UTSW	8	125752284	missense	probably damaging	0.99
R1467:Pcnx2	UTSW	8	125753550	missense	possibly damaging	0.77
R1467:Pcnx2	UTSW	8	125753550	missense	possibly damaging	0.77
R1524:Pcnx2	UTSW	8	125891141	missense	probably benign	0.00
R1537:Pcnx2	UTSW	8	125877449	missense	possibly damaging	0.94
R1574:Pcnx2	UTSW	8	125773930	missense	probably damaging	1.00
R1574:Pcnx2	UTSW	8	125773930	missense	probably damaging	1.00
R1593:Pcnx2	UTSW	8	125759273	missense	probably benign	0.11
R1598:Pcnx2	UTSW	8	125772086	missense	probably benign	0.03
R1603:Pcnx2	UTSW	8	125839626	missense	probably damaging	1.00
R1697:Pcnx2	UTSW	8	125850348	missense	probably damaging	1.00
R1759:Pcnx2	UTSW	8	125773978	missense	probably damaging	1.00
R1855:Pcnx2	UTSW	8	125807996	splice site	probably benign
R1863:Pcnx2	UTSW	8	125818786	missense	probably damaging	0.98
R1930:Pcnx2	UTSW	8	125887714	missense	probably benign	0.10
R1967:Pcnx2	UTSW	8	125815683	missense	possibly damaging	0.51
R1974:Pcnx2	UTSW	8	125887371	missense	probably benign	0.00
R1998:Pcnx2	UTSW	8	125887143	missense	probably damaging	1.00
R2034:Pcnx2	UTSW	8	125818667	critical splice donor site	probably null
R2072:Pcnx2	UTSW	8	125761742	missense	possibly damaging	0.90
R2096:Pcnx2	UTSW	8	125759248	missense	probably benign	0.27
R2216:Pcnx2	UTSW	8	125888077	missense	probably benign	0.00
R2290:Pcnx2	UTSW	8	125877595	splice site	probably benign
R2373:Pcnx2	UTSW	8	125753451	missense	probably damaging	1.00
R2484:Pcnx2	UTSW	8	125891120	missense	probably damaging	1.00
R2849:Pcnx2	UTSW	8	125760927	missense	probably damaging	1.00
R2891:Pcnx2	UTSW	8	125891058	missense	probably damaging	1.00
R2892:Pcnx2	UTSW	8	125891058	missense	probably damaging	1.00
R2970:Pcnx2	UTSW	8	125801536	missense	probably damaging	1.00
R3013:Pcnx2	UTSW	8	125887770	missense	probably benign	0.05
R3608:Pcnx2	UTSW	8	125888101	missense	probably benign
R3876:Pcnx2	UTSW	8	125888158	missense	probably benign
R4349:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4352:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4353:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4361:Pcnx2	UTSW	8	125768298	nonsense	probably null
R4735:Pcnx2	UTSW	8	125828041	critical splice donor site	probably null
R4749:Pcnx2	UTSW	8	125887588	missense	probably damaging	1.00
R4812:Pcnx2	UTSW	8	125865939	missense	probably benign	0.00
R4819:Pcnx2	UTSW	8	125855230	missense	probably benign	0.04
R4829:Pcnx2	UTSW	8	125861058	splice site	probably null
R4832:Pcnx2	UTSW	8	125752188	missense	probably damaging	0.99
R4876:Pcnx2	UTSW	8	125772108	missense	probably damaging	1.00
R4974:Pcnx2	UTSW	8	125851130	missense	probably benign	0.00
R5057:Pcnx2	UTSW	8	125855191	missense	possibly damaging	0.95
R5078:Pcnx2	UTSW	8	125752156	missense	probably benign
R5114:Pcnx2	UTSW	8	125838010	missense	possibly damaging	0.89
R5195:Pcnx2	UTSW	8	125801549	missense	possibly damaging	0.69
R5239:Pcnx2	UTSW	8	125861082	splice site	probably null
R5348:Pcnx2	UTSW	8	125818756	missense	probably damaging	1.00
R5398:Pcnx2	UTSW	8	125887948	missense	possibly damaging	0.63
R5448:Pcnx2	UTSW	8	125888149	missense	probably benign	0.14
R5534:Pcnx2	UTSW	8	125838015	missense	possibly damaging	0.65
R5624:Pcnx2	UTSW	8	125761523	critical splice donor site	probably null
R5629:Pcnx2	UTSW	8	125898041	missense	probably damaging	1.00
R5630:Pcnx2	UTSW	8	125860958	missense	probably damaging	0.99
R5782:Pcnx2	UTSW	8	125753484	missense	probably damaging	1.00
R5877:Pcnx2	UTSW	8	125753728	missense	probably damaging	0.99
R5879:Pcnx2	UTSW	8	125773946	missense	probably damaging	1.00
R6114:Pcnx2	UTSW	8	125773947	missense	probably damaging	1.00
R6152:Pcnx2	UTSW	8	125753752	missense	probably damaging	0.99
R6154:Pcnx2	UTSW	8	125762813	missense	probably damaging	1.00
R6283:Pcnx2	UTSW	8	125877586	missense	probably damaging	0.99
R6500:Pcnx2	UTSW	8	125753485	missense	probably damaging	1.00
R6629:Pcnx2	UTSW	8	125891112	missense	probably benign	0.00
R6708:Pcnx2	UTSW	8	125860953	critical splice donor site	probably null
R6736:Pcnx2	UTSW	8	125752317	splice site	probably null
R6748:Pcnx2	UTSW	8	125850335	missense	probably damaging	1.00
R6788:Pcnx2	UTSW	8	125772100	missense	probably damaging	1.00
R6849:Pcnx2	UTSW	8	125861210	missense	probably damaging	1.00
R6947:Pcnx2	UTSW	8	125850282	critical splice donor site	probably null
R7034:Pcnx2	UTSW	8	125785302	missense	probably damaging	1.00
R7100:Pcnx2	UTSW	8	125759114	missense	probably benign	0.16
R7124:Pcnx2	UTSW	8	125753617	missense	probably damaging	0.99
R7130:Pcnx2	UTSW	8	125753584	nonsense	probably null
R7133:Pcnx2	UTSW	8	125801504	missense	probably benign	0.01
R7271:Pcnx2	UTSW	8	125886951	missense	probably benign
R7326:Pcnx2	UTSW	8	125887083	missense	probably damaging	1.00
R7373:Pcnx2	UTSW	8	125808027	missense	probably damaging	1.00
R7397:Pcnx2	UTSW	8	125890885	splice site	probably null
R7662:Pcnx2	UTSW	8	125818771	nonsense	probably null
R7693:Pcnx2	UTSW	8	125887125	missense	probably benign	0.09
R7726:Pcnx2	UTSW	8	125850330	missense	probably benign	0.00
R7745:Pcnx2	UTSW	8	125851107	missense	probably benign	0.04
R7792:Pcnx2	UTSW	8	125892018	missense	possibly damaging	0.63
R7797:Pcnx2	UTSW	8	125785348	missense	possibly damaging	0.70
R7921:Pcnx2	UTSW	8	125837863	missense	probably benign
R7984:Pcnx2	UTSW	8	125759126	missense	probably benign
R8098:Pcnx2	UTSW	8	125768301	missense	probably damaging	1.00
R8277:Pcnx2	UTSW	8	125866016	missense	probably damaging	1.00
R8312:Pcnx2	UTSW	8	125762850	missense	possibly damaging	0.69
R8354:Pcnx2	UTSW	8	125761618	missense	probably damaging	0.99
R8378:Pcnx2	UTSW	8	125760910	missense	probably damaging	1.00
R8714:Pcnx2	UTSW	8	125773807	missense	probably benign
R8753:Pcnx2	UTSW	8	125887260	missense	probably benign	0.15
R8790:Pcnx2	UTSW	8	125877567	missense	probably benign
R8925:Pcnx2	UTSW	8	125887920	missense	probably benign	0.01
R8927:Pcnx2	UTSW	8	125887920	missense	probably benign	0.01
R8965:Pcnx2	UTSW	8	125759114	missense	probably benign	0.16
R9006:Pcnx2	UTSW	8	125887257	missense	probably benign	0.00
R9082:Pcnx2	UTSW	8	125887014	missense	probably damaging	1.00
R9202:Pcnx2	UTSW	8	125889677	critical splice acceptor site	probably null
R9315:Pcnx2	UTSW	8	125887380	missense	probably benign	0.00
R9434:Pcnx2	UTSW	8	125815773	missense	probably benign	0.00
RF018:Pcnx2	UTSW	8	125877519	missense	probably damaging	1.00
Z1088:Pcnx2	UTSW	8	125826928	missense	probably damaging	1.00
Z1088:Pcnx2	UTSW	8	125866018	missense	probably damaging	1.00
Z1176:Pcnx2	UTSW	8	125761654	missense	probably damaging	1.00
Z1176:Pcnx2	UTSW	8	125838014	missense	probably benign	0.30
Z1177:Pcnx2	UTSW	8	125887960	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGAAAACACTGTGGTCCAAATC -3'
(R):5'- TGAAAACACGGGTGCTGACC -3'

Sequencing Primer
(F):5'- ACACTGTGGTCCAAATCAGTGTG -3'
(R):5'- TCTGTGGACTGGGCAGACTC -3'

Posted On

2021-04-30