Incidental Mutation 'R8713:Slc6a19'
ID 669730
Institutional Source Beutler Lab
Gene Symbol Slc6a19
Ensembl Gene ENSMUSG00000021565
Gene Name solute carrier family 6 (neurotransmitter transporter), member 19
Synonyms B<0>AT1, 4632401C08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R8713 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 73679745-73704865 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 73700621 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 5 (V5L)
Ref Sequence ENSEMBL: ENSMUSP00000022048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022048] [ENSMUST00000124406]
AlphaFold Q9D687
Predicted Effect probably benign
Transcript: ENSMUST00000022048
AA Change: V5L

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022048
Gene: ENSMUSG00000021565
AA Change: V5L

DomainStartEndE-ValueType
Pfam:SNF 32 608 2.3e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124406
AA Change: V5L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000119313
Gene: ENSMUSG00000021565
AA Change: V5L

DomainStartEndE-ValueType
Pfam:SNF 32 79 1.7e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a system B(0) transmembrane protein that actively transports most neutral amino acids across the apical membrane of epithelial cells. Mutations in this gene result in Hartnup disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and impaired amino acid absorption and excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Adam18 T A 8: 24,652,173 M196L probably benign Het
Ankrd10 A G 8: 11,628,491 S134P probably damaging Het
Ano8 C T 8: 71,485,077 G47D probably damaging Het
Arl6ip4 T C 5: 124,116,762 V4A unknown Het
Cabp4 C T 19: 4,136,160 M247I probably benign Het
Ccdc30 A T 4: 119,404,207 L11Q probably damaging Het
Cdkl4 A G 17: 80,533,863 S288P possibly damaging Het
Celsr3 A G 9: 108,829,863 I1182V probably benign Het
Dnah17 T C 11: 118,088,202 D1788G probably damaging Het
Dsp A G 13: 38,168,725 D193G probably damaging Het
Dym T G 18: 75,056,738 Y132* probably null Het
Dync2h1 G A 9: 7,141,008 Q1340* probably null Het
Elmo1 T C 13: 20,274,621 probably benign Het
Fbxw15 A C 9: 109,555,599 F378V possibly damaging Het
Fsip2 G A 2: 82,981,109 G2591R probably damaging Het
Gps2 C A 11: 69,915,354 D148E probably benign Het
Iars2 T C 1: 185,291,418 D772G possibly damaging Het
Ifit1 T A 19: 34,647,638 L58Q probably benign Het
Kctd4 A T 14: 75,962,926 Q112H probably benign Het
Letm1 A G 5: 33,762,505 L230P probably damaging Het
Lrch4 G T 5: 137,639,863 E136* probably null Het
Macc1 T C 12: 119,443,526 probably benign Het
Macrod1 T C 19: 7,057,126 L79P probably benign Het
Map2 T A 1: 66,414,622 N890K probably damaging Het
Mctp1 G A 13: 76,641,803 S270N probably benign Het
Mrpl44 C T 1: 79,777,991 R105C probably damaging Het
Mtg1 T A 7: 140,137,775 probably null Het
Mtg1 T C 7: 140,140,223 F68L probably benign Het
Nfil3 A G 13: 52,968,011 S286P possibly damaging Het
Nutm1 A G 2: 112,251,322 V332A possibly damaging Het
Obscn T A 11: 59,135,966 Q137L probably benign Het
Pcnx2 T G 8: 125,818,786 E1162A probably damaging Het
Pgr A G 9: 8,900,817 D117G possibly damaging Het
Plce1 T C 19: 38,524,901 C215R probably benign Het
Rrm1 T G 7: 102,460,351 Y461D probably damaging Het
Sbk3 C T 7: 4,969,992 V60I possibly damaging Het
Scube1 G T 15: 83,610,270 A852E possibly damaging Het
Sec24d T A 3: 123,343,892 I561N probably damaging Het
Slc16a4 T C 3: 107,311,585 *501Q probably null Het
Spryd3 A G 15: 102,133,485 I34T possibly damaging Het
Syne1 A G 10: 5,316,040 L2191P probably damaging Het
Tbrg1 A G 9: 37,652,659 C227R probably damaging Het
Tdrd6 A G 17: 43,625,019 S1713P probably benign Het
Thap12 C T 7: 98,707,076 L57F probably benign Het
Top1 G A 2: 160,717,440 V628I probably damaging Het
Trim67 A G 8: 124,820,335 M495V probably null Het
Trio A C 15: 27,743,951 probably benign Het
Vmn2r23 A T 6: 123,703,032 Y71F Het
Ywhah A G 5: 33,027,191 N246S probably benign Het
Zcwpw1 T C 5: 137,799,532 I125T probably benign Het
Other mutations in Slc6a19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02401:Slc6a19 APN 13 73700590 missense probably damaging 1.00
IGL02425:Slc6a19 APN 13 73691800 missense probably benign 0.00
IGL03030:Slc6a19 APN 13 73700471 missense probably damaging 1.00
IGL03067:Slc6a19 APN 13 73689730 nonsense probably null
IGL03216:Slc6a19 APN 13 73686181 missense probably benign
IGL03330:Slc6a19 APN 13 73689560 missense possibly damaging 0.95
momentum UTSW 13 73681717 missense probably damaging 0.98
rifling UTSW 13 73685840 nonsense probably null
H8562:Slc6a19 UTSW 13 73700124 intron probably benign
R0107:Slc6a19 UTSW 13 73684057 missense possibly damaging 0.93
R0446:Slc6a19 UTSW 13 73691695 missense probably benign 0.01
R1422:Slc6a19 UTSW 13 73685869 missense probably benign 0.05
R1443:Slc6a19 UTSW 13 73684344 missense probably damaging 1.00
R1501:Slc6a19 UTSW 13 73684048 missense probably benign 0.08
R1564:Slc6a19 UTSW 13 73686124 missense probably damaging 1.00
R1632:Slc6a19 UTSW 13 73689908 splice site probably null
R1832:Slc6a19 UTSW 13 73692950 missense probably benign
R2077:Slc6a19 UTSW 13 73700566 missense probably benign
R4418:Slc6a19 UTSW 13 73684395 missense possibly damaging 0.93
R4486:Slc6a19 UTSW 13 73681717 missense probably damaging 0.98
R4510:Slc6a19 UTSW 13 73683975 missense probably damaging 1.00
R4511:Slc6a19 UTSW 13 73683975 missense probably damaging 1.00
R4803:Slc6a19 UTSW 13 73684042 missense possibly damaging 0.91
R4965:Slc6a19 UTSW 13 73700558 missense probably benign 0.00
R4988:Slc6a19 UTSW 13 73685840 nonsense probably null
R5085:Slc6a19 UTSW 13 73691753 missense probably benign 0.11
R5533:Slc6a19 UTSW 13 73685829 missense possibly damaging 0.67
R5851:Slc6a19 UTSW 13 73691740 missense possibly damaging 0.55
R5874:Slc6a19 UTSW 13 73684368 missense probably damaging 0.98
R6074:Slc6a19 UTSW 13 73689763 missense probably benign 0.00
R6608:Slc6a19 UTSW 13 73683972 missense probably damaging 1.00
R7275:Slc6a19 UTSW 13 73686078 missense probably benign 0.11
R7386:Slc6a19 UTSW 13 73689891 missense possibly damaging 0.91
R7388:Slc6a19 UTSW 13 73693084 missense probably benign 0.30
R7393:Slc6a19 UTSW 13 73692974 missense probably benign 0.00
R7832:Slc6a19 UTSW 13 73693063 missense probably damaging 0.99
R7900:Slc6a19 UTSW 13 73700464 missense probably damaging 1.00
R8220:Slc6a19 UTSW 13 73685770 missense probably damaging 1.00
R8977:Slc6a19 UTSW 13 73682150 missense probably benign
Z1088:Slc6a19 UTSW 13 73689730 missense possibly damaging 0.82
Z1177:Slc6a19 UTSW 13 73684258 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGTGCTATAGCTTCCACCCATAC -3'
(R):5'- TAACAGTTCTGCAGGACGCG -3'

Sequencing Primer
(F):5'- CTCCATGGCTCTGGCATAGGTAG -3'
(R):5'- GCCCTGAGGATCTGCTGAC -3'
Posted On 2021-04-30