Incidental Mutation 'R8713:Cabp4'
ID 669739
Institutional Source Beutler Lab
Gene Symbol Cabp4
Ensembl Gene ENSMUSG00000024842
Gene Name calcium binding protein 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8713 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 4135425-4139609 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 4136160 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 247 (M247I)
Ref Sequence ENSEMBL: ENSMUSP00000025761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025761] [ENSMUST00000096338]
AlphaFold Q8VHC5
PDB Structure NMR structure of Ca2+ bound CaBP4 C-domain [SOLUTION NMR]
NMR structure of Ca2+ bound CaBP4 N-domain [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000025761
AA Change: M247I

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025761
Gene: ENSMUSG00000024842
AA Change: M247I

DomainStartEndE-ValueType
low complexity region 45 67 N/A INTRINSIC
low complexity region 79 97 N/A INTRINSIC
EFh 129 157 1.08e-6 SMART
Blast:EFh 165 193 2e-7 BLAST
EFh 206 234 1.05e-4 SMART
EFh 243 271 1.55e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096338
SMART Domains Protein: ENSMUSP00000094062
Gene: ENSMUSG00000044724

DomainStartEndE-ValueType
Pfam:7tm_1 47 295 7e-19 PFAM
low complexity region 347 361 N/A INTRINSIC
low complexity region 419 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CABP family of calcium binding protein characterized by four EF-hand motifs. Mutations in this gene are associated with congenital stationary night blindness type 2B. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice with disruptions in this gene display structural and electrophysiological abnormalities in the retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Adam18 T A 8: 24,652,173 M196L probably benign Het
Ankrd10 A G 8: 11,628,491 S134P probably damaging Het
Ano8 C T 8: 71,485,077 G47D probably damaging Het
Arl6ip4 T C 5: 124,116,762 V4A unknown Het
Ccdc30 A T 4: 119,404,207 L11Q probably damaging Het
Cdkl4 A G 17: 80,533,863 S288P possibly damaging Het
Celsr3 A G 9: 108,829,863 I1182V probably benign Het
Dnah17 T C 11: 118,088,202 D1788G probably damaging Het
Dsp A G 13: 38,168,725 D193G probably damaging Het
Dym T G 18: 75,056,738 Y132* probably null Het
Dync2h1 G A 9: 7,141,008 Q1340* probably null Het
Elmo1 T C 13: 20,274,621 probably benign Het
Fbxw15 A C 9: 109,555,599 F378V possibly damaging Het
Fsip2 G A 2: 82,981,109 G2591R probably damaging Het
Gps2 C A 11: 69,915,354 D148E probably benign Het
Iars2 T C 1: 185,291,418 D772G possibly damaging Het
Ifit1 T A 19: 34,647,638 L58Q probably benign Het
Kctd4 A T 14: 75,962,926 Q112H probably benign Het
Letm1 A G 5: 33,762,505 L230P probably damaging Het
Lrch4 G T 5: 137,639,863 E136* probably null Het
Macc1 T C 12: 119,443,526 probably benign Het
Macrod1 T C 19: 7,057,126 L79P probably benign Het
Map2 T A 1: 66,414,622 N890K probably damaging Het
Mctp1 G A 13: 76,641,803 S270N probably benign Het
Mrpl44 C T 1: 79,777,991 R105C probably damaging Het
Mtg1 T A 7: 140,137,775 probably null Het
Mtg1 T C 7: 140,140,223 F68L probably benign Het
Nfil3 A G 13: 52,968,011 S286P possibly damaging Het
Nutm1 A G 2: 112,251,322 V332A possibly damaging Het
Obscn T A 11: 59,135,966 Q137L probably benign Het
Pcnx2 T G 8: 125,818,786 E1162A probably damaging Het
Pgr A G 9: 8,900,817 D117G possibly damaging Het
Plce1 T C 19: 38,524,901 C215R probably benign Het
Rrm1 T G 7: 102,460,351 Y461D probably damaging Het
Sbk3 C T 7: 4,969,992 V60I possibly damaging Het
Scube1 G T 15: 83,610,270 A852E possibly damaging Het
Sec24d T A 3: 123,343,892 I561N probably damaging Het
Slc16a4 T C 3: 107,311,585 *501Q probably null Het
Slc6a19 C A 13: 73,700,621 V5L probably benign Het
Spryd3 A G 15: 102,133,485 I34T possibly damaging Het
Syne1 A G 10: 5,316,040 L2191P probably damaging Het
Tbrg1 A G 9: 37,652,659 C227R probably damaging Het
Tdrd6 A G 17: 43,625,019 S1713P probably benign Het
Thap12 C T 7: 98,707,076 L57F probably benign Het
Top1 G A 2: 160,717,440 V628I probably damaging Het
Trim67 A G 8: 124,820,335 M495V probably null Het
Trio A C 15: 27,743,951 probably benign Het
Vmn2r23 A T 6: 123,703,032 Y71F Het
Ywhah A G 5: 33,027,191 N246S probably benign Het
Zcwpw1 T C 5: 137,799,532 I125T probably benign Het
Other mutations in Cabp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Cabp4 APN 19 4139407 missense possibly damaging 0.88
IGL01372:Cabp4 APN 19 4139323 missense probably benign 0.15
IGL01650:Cabp4 APN 19 4139324 missense probably benign
IGL02756:Cabp4 APN 19 4138561 missense possibly damaging 0.75
R4809:Cabp4 UTSW 19 4139291 missense probably benign
R4909:Cabp4 UTSW 19 4137121 missense possibly damaging 0.76
R5252:Cabp4 UTSW 19 4136068 unclassified probably benign
R5502:Cabp4 UTSW 19 4131229 unclassified probably benign
R5609:Cabp4 UTSW 19 4139252 missense probably benign 0.37
R7474:Cabp4 UTSW 19 4139399 missense probably benign 0.02
R7732:Cabp4 UTSW 19 4135995 missense probably benign 0.34
R9218:Cabp4 UTSW 19 4138694 critical splice acceptor site probably null
X0020:Cabp4 UTSW 19 4139307 missense probably benign
Z1177:Cabp4 UTSW 19 4136222 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAGGCAGACTCTGGAGTTG -3'
(R):5'- GAGCCATATGTATGCAGATATGC -3'

Sequencing Primer
(F):5'- CCAGTAGGTTGTCCCTGAAG -3'
(R):5'- TGCAGATATGCAGATAAGGTGGC -3'
Posted On 2021-04-30