Incidental Mutation 'R8714:Bard1'
ID 669745
Institutional Source Beutler Lab
Gene Symbol Bard1
Ensembl Gene ENSMUSG00000026196
Gene Name BRCA1 associated RING domain 1
Synonyms ENSMUSG00000073653, ENSMUSG00000060893
MMRRC Submission 068568-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8714 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 71066690-71142300 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71069986 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 664 (Y664C)
Ref Sequence ENSEMBL: ENSMUSP00000027393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027393]
AlphaFold O70445
Predicted Effect probably damaging
Transcript: ENSMUST00000027393
AA Change: Y664C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027393
Gene: ENSMUSG00000026196
AA Change: Y664C

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
RING 44 80 3.71e-2 SMART
low complexity region 225 232 N/A INTRINSIC
low complexity region 371 390 N/A INTRINSIC
ANK 415 444 3.46e-4 SMART
ANK 448 477 8.32e-7 SMART
ANK 481 510 1.55e-6 SMART
BRCT 553 631 3.56e-10 SMART
BRCT 657 758 2.35e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions of this gene fail to develop past the egg cylinder stage. The phenotype is similar to that of mice with homozygous for disruptions in Brca1 or homozygous for disruptions in both Bard1 and Brca1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,100,093 (GRCm39) A137T probably benign Het
4930474N05Rik T A 14: 35,818,456 (GRCm39) C151* probably null Het
Abca4 A G 3: 121,942,528 (GRCm39) T1674A probably benign Het
Acat3 A T 17: 13,147,516 (GRCm39) V167E probably benign Het
Alb T C 5: 90,608,874 (GRCm39) probably null Het
Apol9a T C 15: 77,288,942 (GRCm39) T142A probably benign Het
Asb14 C T 14: 26,623,032 (GRCm39) P135S possibly damaging Het
Asb17 A G 3: 153,556,313 (GRCm39) Y140C probably damaging Het
Atp4a T A 7: 30,420,013 (GRCm39) I750N probably damaging Het
Cacnb3 G A 15: 98,530,262 (GRCm39) probably benign Het
Card11 T A 5: 140,899,147 (GRCm39) D9V possibly damaging Het
Casp8 A T 1: 58,872,812 (GRCm39) Q229H possibly damaging Het
Ccdc88b T C 19: 6,833,213 (GRCm39) E278G probably damaging Het
Cd209d CAT C 8: 3,923,772 (GRCm39) probably null Het
Cep350 T C 1: 155,736,477 (GRCm39) D2853G probably damaging Het
Cfap161 T C 7: 83,442,482 (GRCm39) I110M probably benign Het
Chid1 T A 7: 141,093,678 (GRCm39) K313* probably null Het
Col16a1 T A 4: 129,947,961 (GRCm39) I227N unknown Het
D3Ertd751e G T 3: 41,700,998 (GRCm39) E6* probably null Het
Ddx41 T C 13: 55,682,250 (GRCm39) Q208R probably damaging Het
Dhrs13 G C 11: 77,923,492 (GRCm39) R70P possibly damaging Het
Dmrta1 A T 4: 89,579,682 (GRCm39) Q214L probably benign Het
Eif2ak4 T C 2: 118,292,765 (GRCm39) F1330L possibly damaging Het
Fbxw13 C T 9: 109,023,832 (GRCm39) V71I probably benign Het
H2-Q2 T C 17: 35,562,338 (GRCm39) L195P possibly damaging Het
Hemgn C T 4: 46,395,904 (GRCm39) G444D probably damaging Het
Lmtk2 A G 5: 144,112,876 (GRCm39) T1199A probably damaging Het
Ly75 T C 2: 60,164,829 (GRCm39) D783G probably damaging Het
Micall1 G A 15: 79,011,510 (GRCm39) A627T probably benign Het
Morc2a C T 11: 3,625,877 (GRCm39) T159I probably benign Het
Mthfr C A 4: 148,126,275 (GRCm39) N115K probably damaging Het
Muc1 G A 3: 89,138,821 (GRCm39) V477M possibly damaging Het
Mug1 C T 6: 121,859,681 (GRCm39) P1227S probably benign Het
Ogfod3 T A 11: 121,087,608 (GRCm39) D163V possibly damaging Het
Or51a43 T A 7: 103,717,483 (GRCm39) I252F probably damaging Het
Pcnx2 C T 8: 126,500,546 (GRCm39) V1515I probably benign Het
Plat G T 8: 23,262,248 (GRCm39) G91W probably damaging Het
Plscr3 G T 11: 69,738,838 (GRCm39) G167C probably benign Het
Plxna4 T A 6: 32,140,379 (GRCm39) K1670* probably null Het
Prb1c G A 6: 132,341,051 (GRCm39) T7I unknown Het
Rab7 T C 6: 87,989,369 (GRCm39) S34G probably damaging Het
Rnf157 C A 11: 116,237,891 (GRCm39) A577S probably benign Het
Rnf213 C T 11: 119,359,720 (GRCm39) S4371L Het
S1pr1 A T 3: 115,505,470 (GRCm39) S375T probably benign Het
Spen T C 4: 141,215,314 (GRCm39) N506S unknown Het
Sulf1 T A 1: 12,878,141 (GRCm39) Y210N probably benign Het
Tenm4 C T 7: 96,555,148 (GRCm39) P2618S probably benign Het
Tg A G 15: 66,555,891 (GRCm39) N861S probably damaging Het
Ttc29 A G 8: 79,060,331 (GRCm39) E417G possibly damaging Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Ubxn7 T A 16: 32,186,229 (GRCm39) probably benign Het
Vmn1r62 C A 7: 5,678,629 (GRCm39) Y103* probably null Het
Zfp804b A T 5: 6,822,378 (GRCm39) Y228* probably null Het
Other mutations in Bard1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Bard1 APN 1 71,070,585 (GRCm39) missense probably benign 0.08
IGL02128:Bard1 APN 1 71,114,387 (GRCm39) missense possibly damaging 0.66
IGL02249:Bard1 APN 1 71,092,828 (GRCm39) missense probably damaging 1.00
IGL02552:Bard1 APN 1 71,104,815 (GRCm39) splice site probably benign
IGL02661:Bard1 APN 1 71,114,469 (GRCm39) missense probably damaging 1.00
IGL03087:Bard1 APN 1 71,106,289 (GRCm39) missense probably damaging 1.00
PIT4651001:Bard1 UTSW 1 71,114,087 (GRCm39) missense probably benign 0.00
R0096:Bard1 UTSW 1 71,092,889 (GRCm39) splice site probably benign
R0328:Bard1 UTSW 1 71,085,921 (GRCm39) missense probably benign 0.29
R0838:Bard1 UTSW 1 71,069,812 (GRCm39) missense probably damaging 1.00
R2007:Bard1 UTSW 1 71,070,562 (GRCm39) missense probably benign 0.00
R2055:Bard1 UTSW 1 71,114,031 (GRCm39) missense probably benign 0.00
R2110:Bard1 UTSW 1 71,114,550 (GRCm39) nonsense probably null
R2237:Bard1 UTSW 1 71,114,135 (GRCm39) missense probably damaging 1.00
R2416:Bard1 UTSW 1 71,113,811 (GRCm39) missense probably benign
R3054:Bard1 UTSW 1 71,127,390 (GRCm39) missense possibly damaging 0.77
R3055:Bard1 UTSW 1 71,127,390 (GRCm39) missense possibly damaging 0.77
R3056:Bard1 UTSW 1 71,127,390 (GRCm39) missense possibly damaging 0.77
R3871:Bard1 UTSW 1 71,114,099 (GRCm39) missense probably benign 0.05
R3905:Bard1 UTSW 1 71,106,339 (GRCm39) missense possibly damaging 0.70
R4117:Bard1 UTSW 1 71,085,922 (GRCm39) missense probably damaging 1.00
R4766:Bard1 UTSW 1 71,114,333 (GRCm39) missense probably benign 0.01
R5230:Bard1 UTSW 1 71,092,770 (GRCm39) critical splice donor site probably null
R5250:Bard1 UTSW 1 71,113,722 (GRCm39) missense probably damaging 1.00
R5531:Bard1 UTSW 1 71,085,880 (GRCm39) missense probably damaging 1.00
R5653:Bard1 UTSW 1 71,070,588 (GRCm39) missense probably benign
R6008:Bard1 UTSW 1 71,069,909 (GRCm39) missense possibly damaging 0.65
R7503:Bard1 UTSW 1 71,069,995 (GRCm39) missense probably damaging 1.00
R7543:Bard1 UTSW 1 71,114,589 (GRCm39) missense probably damaging 1.00
R7750:Bard1 UTSW 1 71,106,101 (GRCm39) splice site probably null
R8134:Bard1 UTSW 1 71,106,297 (GRCm39) missense probably damaging 1.00
R9057:Bard1 UTSW 1 71,069,807 (GRCm39) missense probably damaging 1.00
R9534:Bard1 UTSW 1 71,114,189 (GRCm39) missense probably benign 0.45
V8831:Bard1 UTSW 1 71,127,376 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACAGTTAAACAGGTCTTCGTAG -3'
(R):5'- CTGCAGCTTTAATGGACAATATTCC -3'

Sequencing Primer
(F):5'- CGTAGACGATGTACTGCGTAC -3'
(R):5'- TGGCTCTTTCTGACACGT -3'
Posted On 2021-04-30