Incidental Mutation 'R8715:Osbpl9'
ID669805
Institutional Source Beutler Lab
Gene Symbol Osbpl9
Ensembl Gene ENSMUSG00000028559
Gene Nameoxysterol binding protein-like 9
SynonymsORP-9, 2600011I06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8715 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location109061145-109202272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109102576 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 15 (F15S)
Ref Sequence ENSEMBL: ENSMUSP00000081396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030288] [ENSMUST00000084366] [ENSMUST00000159545] [ENSMUST00000160271] [ENSMUST00000160774] [ENSMUST00000161363] [ENSMUST00000162787] [ENSMUST00000194478]
Predicted Effect probably benign
Transcript: ENSMUST00000030288
AA Change: F112S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030288
Gene: ENSMUSG00000028559
AA Change: F112S

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 253 274 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 349 362 N/A INTRINSIC
Pfam:Oxysterol_BP 377 729 7.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084366
AA Change: F15S

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000081396
Gene: ENSMUSG00000028559
AA Change: F15S

DomainStartEndE-ValueType
low complexity region 156 177 N/A INTRINSIC
low complexity region 188 204 N/A INTRINSIC
low complexity region 252 265 N/A INTRINSIC
Pfam:Oxysterol_BP 277 634 7.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159545
SMART Domains Protein: ENSMUSP00000123856
Gene: ENSMUSG00000028559

DomainStartEndE-ValueType
Blast:PH 3 54 6e-33 BLAST
SCOP:d1pls__ 4 46 9e-8 SMART
PDB:2KCJ|A 4 55 1e-10 PDB
Predicted Effect
SMART Domains Protein: ENSMUSP00000124112
Gene: ENSMUSG00000028559
AA Change: F15S

DomainStartEndE-ValueType
low complexity region 143 164 N/A INTRINSIC
low complexity region 175 191 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
Pfam:Oxysterol_BP 264 621 4.7e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160774
AA Change: F95S

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124742
Gene: ENSMUSG00000028559
AA Change: F95S

DomainStartEndE-ValueType
PH 3 84 6.46e-8 SMART
low complexity region 236 257 N/A INTRINSIC
low complexity region 268 284 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
Pfam:Oxysterol_BP 357 714 2.8e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161363
AA Change: F45S

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125714
Gene: ENSMUSG00000028559
AA Change: F45S

DomainStartEndE-ValueType
Blast:PH 13 34 3e-6 BLAST
low complexity region 173 194 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 269 282 N/A INTRINSIC
Pfam:Oxysterol_BP 294 651 2.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162787
AA Change: F112S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000124370
Gene: ENSMUSG00000028559
AA Change: F112S

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 272 288 N/A INTRINSIC
low complexity region 336 349 N/A INTRINSIC
Pfam:Oxysterol_BP 361 718 2.8e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194478
AA Change: F135S

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141991
Gene: ENSMUSG00000028559
AA Change: F135S

DomainStartEndE-ValueType
PH 3 101 3.7e-19 SMART
low complexity region 263 284 N/A INTRINSIC
low complexity region 295 311 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Oxysterol_BP 384 741 2e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. This family member functions as a cholesterol transfer protein that regulates Golgi structure and function. Multiple transcript variants, most of which encode distinct isoforms, have been identified. Related pseudogenes have been identified on chromosomes 3, 11 and 12. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik A C 15: 84,417,145 V99G probably damaging Het
Abcb1b A T 5: 8,812,750 H144L probably benign Het
Adam25 A G 8: 40,754,062 N122D probably benign Het
Armc10 T C 5: 21,653,518 F187S possibly damaging Het
Best3 T A 10: 116,993,066 F84I probably damaging Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccdc60 A T 5: 116,190,094 F104I probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cd209d CAT C 8: 3,873,772 probably null Het
Cdhr4 G A 9: 107,997,397 V9M Het
Cfap46 T C 7: 139,605,644 T41A Het
Cyp2c66 A G 19: 39,170,944 T280A probably benign Het
Dis3l C T 9: 64,307,060 D1049N probably benign Het
Dlc1 T A 8: 36,938,641 probably benign Het
Faap100 T C 11: 120,374,473 T526A probably benign Het
Fam214b A G 4: 43,033,944 V444A possibly damaging Het
Gimap6 A T 6: 48,702,618 D161E probably damaging Het
Gmpr T C 13: 45,542,626 V282A possibly damaging Het
Gsap A G 5: 21,226,247 I190V possibly damaging Het
Gucy2d C T 7: 98,444,112 T232I probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lrp1 C A 10: 127,560,621 S2358I possibly damaging Het
Lrrc74a A G 12: 86,758,465 N354D probably damaging Het
Mdga2 T C 12: 66,868,752 E112G probably damaging Het
Msh6 C T 17: 87,985,767 T650I probably benign Het
Mst1 T C 9: 108,082,043 V203A possibly damaging Het
Muc1 G A 3: 89,231,514 V477M possibly damaging Het
Naa11 A G 5: 97,392,207 Y31H probably damaging Het
Nphp1 G T 2: 127,763,809 H365Q possibly damaging Het
Olfr1025-ps1 G A 2: 85,917,929 M1I probably null Het
Olfr1390 A T 11: 49,341,327 Y265F probably damaging Het
Olfr409-ps1 T A 11: 74,317,160 I45N probably damaging Het
Pcdha12 A C 18: 37,020,470 N81H probably damaging Het
Pde4d A G 13: 109,935,342 Q290R probably benign Het
Pla1a A T 16: 38,409,638 N237K probably damaging Het
Podnl1 T C 8: 84,129,327 Y239H Het
Pou4f3 G T 18: 42,395,528 D179Y possibly damaging Het
Ptch2 T C 4: 117,111,522 V995A probably damaging Het
Ptprt C T 2: 161,530,543 C1403Y probably damaging Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rspry1 A G 8: 94,623,260 E92G probably damaging Het
Sdccag8 T A 1: 176,946,237 probably benign Het
Sdk2 G A 11: 113,780,902 T2140M probably damaging Het
Serpina1e T C 12: 103,950,918 N164S probably benign Het
Tdrkh T C 3: 94,424,661 V131A probably damaging Het
Tm9sf3 T A 19: 41,256,285 N51I probably damaging Het
Trav4-3 A G 14: 53,599,305 N76D possibly damaging Het
Trhr2 T A 8: 122,358,880 I122F probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn2r99 A T 17: 19,393,660 probably benign Het
Zfp663 T C 2: 165,352,724 E525G probably damaging Het
Zfp976 C T 7: 42,613,445 E324K possibly damaging Het
Other mutations in Osbpl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Osbpl9 APN 4 109072010 missense probably damaging 1.00
IGL00793:Osbpl9 APN 4 109087431 missense probably damaging 0.99
IGL00809:Osbpl9 APN 4 109133763 missense probably damaging 1.00
IGL02071:Osbpl9 APN 4 109071979 missense probably damaging 1.00
IGL02547:Osbpl9 APN 4 109068483 nonsense probably null
IGL02822:Osbpl9 APN 4 109072921 missense probably damaging 1.00
IGL03074:Osbpl9 APN 4 109071961 missense probably damaging 1.00
IGL03193:Osbpl9 APN 4 109066966 missense possibly damaging 0.90
IGL03196:Osbpl9 APN 4 109072864 missense probably damaging 1.00
IGL03306:Osbpl9 APN 4 109172332 splice site probably benign
IGL03323:Osbpl9 APN 4 109062459 splice site probably benign
Oblong UTSW 4 109091679 missense possibly damaging 0.62
R0211:Osbpl9 UTSW 4 109073124 missense probably damaging 1.00
R0368:Osbpl9 UTSW 4 109066932 missense probably damaging 1.00
R0620:Osbpl9 UTSW 4 109083128 missense probably damaging 1.00
R1439:Osbpl9 UTSW 4 109101156 missense probably damaging 1.00
R1711:Osbpl9 UTSW 4 109066218 missense probably damaging 1.00
R1757:Osbpl9 UTSW 4 109064583 missense probably damaging 1.00
R2237:Osbpl9 UTSW 4 109156657 missense probably damaging 1.00
R2295:Osbpl9 UTSW 4 109202134 missense probably damaging 0.99
R2418:Osbpl9 UTSW 4 109066218 missense probably damaging 1.00
R3111:Osbpl9 UTSW 4 109083093 missense probably benign 0.08
R4202:Osbpl9 UTSW 4 109172240 intron probably benign
R4672:Osbpl9 UTSW 4 109064609 missense possibly damaging 0.82
R4706:Osbpl9 UTSW 4 109156687 missense probably damaging 1.00
R4856:Osbpl9 UTSW 4 109068367 missense probably benign 0.38
R4886:Osbpl9 UTSW 4 109068367 missense probably benign 0.38
R5035:Osbpl9 UTSW 4 109066167 missense probably damaging 0.99
R5309:Osbpl9 UTSW 4 109066155 missense probably damaging 1.00
R5400:Osbpl9 UTSW 4 109062300 nonsense probably null
R5719:Osbpl9 UTSW 4 109062566 nonsense probably null
R5810:Osbpl9 UTSW 4 109086374 missense probably benign 0.00
R6237:Osbpl9 UTSW 4 109156702 missense probably damaging 1.00
R6575:Osbpl9 UTSW 4 109072932 missense possibly damaging 0.89
R6648:Osbpl9 UTSW 4 109091679 missense possibly damaging 0.62
R6675:Osbpl9 UTSW 4 109133828 splice site probably null
R7130:Osbpl9 UTSW 4 109083099 missense probably benign
R7356:Osbpl9 UTSW 4 109068480 nonsense probably null
R7615:Osbpl9 UTSW 4 109086339 missense probably damaging 1.00
R7753:Osbpl9 UTSW 4 109133773 missense possibly damaging 0.86
R7772:Osbpl9 UTSW 4 109066187 missense probably damaging 0.99
R7788:Osbpl9 UTSW 4 109062494 missense probably benign 0.41
R8083:Osbpl9 UTSW 4 109086375 missense possibly damaging 0.74
R8143:Osbpl9 UTSW 4 109065709 missense probably benign 0.12
R8323:Osbpl9 UTSW 4 109107922 missense probably benign 0.01
R8331:Osbpl9 UTSW 4 109066181 missense probably damaging 1.00
R8406:Osbpl9 UTSW 4 109064573 missense possibly damaging 0.82
R8531:Osbpl9 UTSW 4 109156711 missense probably damaging 1.00
R8888:Osbpl9 UTSW 4 109073136 missense probably benign 0.03
R8895:Osbpl9 UTSW 4 109073136 missense probably benign 0.03
Z1177:Osbpl9 UTSW 4 109107880 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGAAGTCGCTGGAAGGATG -3'
(R):5'- CCTTTCCTTTGAGCAGCAGC -3'

Sequencing Primer
(F):5'- CGCTGGAAGGATGTAAATTGCCATC -3'
(R):5'- CAGCTACATGTGTAACTGCTGAG -3'
Posted On2021-04-30