Incidental Mutation 'R8715:Cfap46'
ID669819
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Namecilia and flagella associated protein 46
Synonyms9330101J02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8715 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location139600951-139683817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139605644 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 41 (T41A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990]
Predicted Effect unknown
Transcript: ENSMUST00000129990
AA Change: T2486A
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: T2486A

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik A C 15: 84,417,145 V99G probably damaging Het
Abcb1b A T 5: 8,812,750 H144L probably benign Het
Adam25 A G 8: 40,754,062 N122D probably benign Het
Armc10 T C 5: 21,653,518 F187S possibly damaging Het
Best3 T A 10: 116,993,066 F84I probably damaging Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccdc60 A T 5: 116,190,094 F104I probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cd209d CAT C 8: 3,873,772 probably null Het
Cdhr4 G A 9: 107,997,397 V9M Het
Cyp2c66 A G 19: 39,170,944 T280A probably benign Het
Dis3l C T 9: 64,307,060 D1049N probably benign Het
Dlc1 T A 8: 36,938,641 probably benign Het
Faap100 T C 11: 120,374,473 T526A probably benign Het
Fam214b A G 4: 43,033,944 V444A possibly damaging Het
Gimap6 A T 6: 48,702,618 D161E probably damaging Het
Gmpr T C 13: 45,542,626 V282A possibly damaging Het
Gsap A G 5: 21,226,247 I190V possibly damaging Het
Gucy2d C T 7: 98,444,112 T232I probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lrp1 C A 10: 127,560,621 S2358I possibly damaging Het
Lrrc74a A G 12: 86,758,465 N354D probably damaging Het
Mdga2 T C 12: 66,868,752 E112G probably damaging Het
Msh6 C T 17: 87,985,767 T650I probably benign Het
Mst1 T C 9: 108,082,043 V203A possibly damaging Het
Muc1 G A 3: 89,231,514 V477M possibly damaging Het
Naa11 A G 5: 97,392,207 Y31H probably damaging Het
Nphp1 G T 2: 127,763,809 H365Q possibly damaging Het
Olfr1025-ps1 G A 2: 85,917,929 M1I probably null Het
Olfr1390 A T 11: 49,341,327 Y265F probably damaging Het
Olfr409-ps1 T A 11: 74,317,160 I45N probably damaging Het
Osbpl9 A G 4: 109,102,576 F15S probably benign Het
Pcdha12 A C 18: 37,020,470 N81H probably damaging Het
Pde4d A G 13: 109,935,342 Q290R probably benign Het
Pla1a A T 16: 38,409,638 N237K probably damaging Het
Podnl1 T C 8: 84,129,327 Y239H Het
Pou4f3 G T 18: 42,395,528 D179Y possibly damaging Het
Ptch2 T C 4: 117,111,522 V995A probably damaging Het
Ptprt C T 2: 161,530,543 C1403Y probably damaging Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rspry1 A G 8: 94,623,260 E92G probably damaging Het
Sdccag8 T A 1: 176,946,237 probably benign Het
Sdk2 G A 11: 113,780,902 T2140M probably damaging Het
Serpina1e T C 12: 103,950,918 N164S probably benign Het
Tdrkh T C 3: 94,424,661 V131A probably damaging Het
Tm9sf3 T A 19: 41,256,285 N51I probably damaging Het
Trav4-3 A G 14: 53,599,305 N76D possibly damaging Het
Trhr2 T A 8: 122,358,880 I122F probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn2r99 A T 17: 19,393,660 probably benign Het
Zfp663 T C 2: 165,352,724 E525G probably damaging Het
Zfp976 C T 7: 42,613,445 E324K possibly damaging Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7327:Cfap46 UTSW 7 139635146 splice site probably null
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
R7765:Cfap46 UTSW 7 139651564 missense
R7971:Cfap46 UTSW 7 139635127 missense unknown
R8211:Cfap46 UTSW 7 139633304 missense unknown
R8306:Cfap46 UTSW 7 139656580 missense
R8354:Cfap46 UTSW 7 139653498 missense probably benign 0.03
R8365:Cfap46 UTSW 7 139683084 nonsense probably null
R8447:Cfap46 UTSW 7 139680986 missense possibly damaging 0.90
R8805:Cfap46 UTSW 7 139632063 missense unknown
R8830:Cfap46 UTSW 7 139615649 missense unknown
R8920:Cfap46 UTSW 7 139652526 missense
RF023:Cfap46 UTSW 7 139638918
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139639548 missense
Z1177:Cfap46 UTSW 7 139601267 missense unknown
Z1177:Cfap46 UTSW 7 139630626 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCCTGAAGCATTGCCCTGG -3'
(R):5'- ATCTGAGGCCAGCTGTACAC -3'

Sequencing Primer
(F):5'- ATTGCCCTGGACTCTGGATCAAG -3'
(R):5'- TAATTTGGGCCCCACAGCAG -3'
Posted On2021-04-30