Incidental Mutation 'R8715:Rspry1'
ID669824
Institutional Source Beutler Lab
Gene Symbol Rspry1
Ensembl Gene ENSMUSG00000050079
Gene Namering finger and SPRY domain containing 1
Synonyms4930470D19Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R8715 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location94601937-94660275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94623260 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 92 (E92G)
Ref Sequence ENSEMBL: ENSMUSP00000057275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000121101] [ENSMUST00000211983] [ENSMUST00000212729]
Predicted Effect probably damaging
Transcript: ENSMUST00000060389
AA Change: E92G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079
AA Change: E92G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
SPRY 358 482 2.94e-26 SMART
RING 527 561 3.93e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121101
AA Change: E92G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112482
Gene: ENSMUSG00000050079
AA Change: E92G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211983
AA Change: E92G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000212729
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik A C 15: 84,417,145 V99G probably damaging Het
Abcb1b A T 5: 8,812,750 H144L probably benign Het
Adam25 A G 8: 40,754,062 N122D probably benign Het
Armc10 T C 5: 21,653,518 F187S possibly damaging Het
Best3 T A 10: 116,993,066 F84I probably damaging Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccdc60 A T 5: 116,190,094 F104I probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cd209d CAT C 8: 3,873,772 probably null Het
Cdhr4 G A 9: 107,997,397 V9M Het
Cfap46 T C 7: 139,605,644 T41A Het
Cyp2c66 A G 19: 39,170,944 T280A probably benign Het
Dis3l C T 9: 64,307,060 D1049N probably benign Het
Dlc1 T A 8: 36,938,641 probably benign Het
Faap100 T C 11: 120,374,473 T526A probably benign Het
Fam214b A G 4: 43,033,944 V444A possibly damaging Het
Gimap6 A T 6: 48,702,618 D161E probably damaging Het
Gmpr T C 13: 45,542,626 V282A possibly damaging Het
Gsap A G 5: 21,226,247 I190V possibly damaging Het
Gucy2d C T 7: 98,444,112 T232I probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lrp1 C A 10: 127,560,621 S2358I possibly damaging Het
Lrrc74a A G 12: 86,758,465 N354D probably damaging Het
Mdga2 T C 12: 66,868,752 E112G probably damaging Het
Msh6 C T 17: 87,985,767 T650I probably benign Het
Mst1 T C 9: 108,082,043 V203A possibly damaging Het
Muc1 G A 3: 89,231,514 V477M possibly damaging Het
Naa11 A G 5: 97,392,207 Y31H probably damaging Het
Nphp1 G T 2: 127,763,809 H365Q possibly damaging Het
Olfr1025-ps1 G A 2: 85,917,929 M1I probably null Het
Olfr1390 A T 11: 49,341,327 Y265F probably damaging Het
Olfr409-ps1 T A 11: 74,317,160 I45N probably damaging Het
Osbpl9 A G 4: 109,102,576 F15S probably benign Het
Pcdha12 A C 18: 37,020,470 N81H probably damaging Het
Pde4d A G 13: 109,935,342 Q290R probably benign Het
Pla1a A T 16: 38,409,638 N237K probably damaging Het
Podnl1 T C 8: 84,129,327 Y239H Het
Pou4f3 G T 18: 42,395,528 D179Y possibly damaging Het
Ptch2 T C 4: 117,111,522 V995A probably damaging Het
Ptprt C T 2: 161,530,543 C1403Y probably damaging Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Sdccag8 T A 1: 176,946,237 probably benign Het
Sdk2 G A 11: 113,780,902 T2140M probably damaging Het
Serpina1e T C 12: 103,950,918 N164S probably benign Het
Tdrkh T C 3: 94,424,661 V131A probably damaging Het
Tm9sf3 T A 19: 41,256,285 N51I probably damaging Het
Trav4-3 A G 14: 53,599,305 N76D possibly damaging Het
Trhr2 T A 8: 122,358,880 I122F probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn2r99 A T 17: 19,393,660 probably benign Het
Zfp663 T C 2: 165,352,724 E525G probably damaging Het
Zfp976 C T 7: 42,613,445 E324K possibly damaging Het
Other mutations in Rspry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rspry1 APN 8 94622986 start codon destroyed probably null 0.89
IGL00158:Rspry1 APN 8 94622980 intron probably benign
IGL01141:Rspry1 APN 8 94649855 missense probably benign 0.00
IGL01860:Rspry1 APN 8 94649816 missense probably benign 0.00
IGL02174:Rspry1 APN 8 94633140 missense possibly damaging 0.84
IGL02819:Rspry1 APN 8 94654256 missense probably benign 0.42
IGL02926:Rspry1 APN 8 94649811 missense probably damaging 1.00
IGL03366:Rspry1 APN 8 94650334 missense probably benign 0.00
R0570:Rspry1 UTSW 8 94629792 missense probably damaging 1.00
R1833:Rspry1 UTSW 8 94635488 missense probably damaging 1.00
R1988:Rspry1 UTSW 8 94632054 critical splice acceptor site probably null
R2444:Rspry1 UTSW 8 94623107 missense probably damaging 1.00
R3623:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R3624:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R4275:Rspry1 UTSW 8 94649761 missense probably benign 0.00
R4888:Rspry1 UTSW 8 94658789 missense probably benign 0.19
R5026:Rspry1 UTSW 8 94650303 missense probably damaging 1.00
R5310:Rspry1 UTSW 8 94623185 missense probably benign
R5374:Rspry1 UTSW 8 94623008 missense probably benign 0.00
R5374:Rspry1 UTSW 8 94654264 missense probably benign 0.38
R5387:Rspry1 UTSW 8 94638286 missense possibly damaging 0.95
R5517:Rspry1 UTSW 8 94636760 splice site probably null
R5631:Rspry1 UTSW 8 94629078 start codon destroyed possibly damaging 0.79
R5653:Rspry1 UTSW 8 94636611 splice site probably null
R6065:Rspry1 UTSW 8 94622987 start codon destroyed probably null 0.98
R6220:Rspry1 UTSW 8 94658750 missense probably damaging 1.00
R6276:Rspry1 UTSW 8 94623258 missense probably damaging 1.00
R6821:Rspry1 UTSW 8 94635431 nonsense probably null
R7390:Rspry1 UTSW 8 94623185 missense probably benign
R7460:Rspry1 UTSW 8 94650335 missense probably benign 0.00
R7644:Rspry1 UTSW 8 94658768 missense probably benign 0.00
R7717:Rspry1 UTSW 8 94623122 missense probably damaging 1.00
R7768:Rspry1 UTSW 8 94629841 missense probably damaging 1.00
R7940:Rspry1 UTSW 8 94623007 missense probably benign 0.22
R7978:Rspry1 UTSW 8 94623125 missense probably damaging 0.98
R8087:Rspry1 UTSW 8 94654297 missense probably benign 0.04
R8174:Rspry1 UTSW 8 94649822 missense probably damaging 0.97
R8326:Rspry1 UTSW 8 94639589 missense probably damaging 1.00
R8676:Rspry1 UTSW 8 94632119 missense probably benign 0.01
R8869:Rspry1 UTSW 8 94633152 missense probably damaging 0.97
X0010:Rspry1 UTSW 8 94629801 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GCACATAGCCCACCTATTGG -3'
(R):5'- CTCTCTTGGCCTATGAGCACAAG -3'

Sequencing Primer
(F):5'- CACCTATTGGGGACTACAGGTG -3'
(R):5'- GCACAAGGCTTGGAAAATATATCC -3'
Posted On2021-04-30