Incidental Mutation 'R8715:Mst1'
ID669828
Institutional Source Beutler Lab
Gene Symbol Mst1
Ensembl Gene ENSMUSG00000032591
Gene Namemacrophage stimulating 1 (hepatocyte growth factor-like)
SynonymsD9H3F15S2, DNF15S2h, D3F15S2h, Hgfl
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8715 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108080436-108085003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108082043 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 203 (V203A)
Ref Sequence ENSEMBL: ENSMUSP00000035211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035211] [ENSMUST00000047746] [ENSMUST00000159372] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000162886] [ENSMUST00000174504] [ENSMUST00000178267] [ENSMUST00000193254]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035211
AA Change: V203A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035211
Gene: ENSMUSG00000032591
AA Change: V203A

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 8.57e-46 SMART
KR 290 372 7.94e-41 SMART
KR 377 459 6.59e-47 SMART
Tryp_SPc 488 709 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081309
SMART Domains Protein: ENSMUSP00000080058
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 2e-8 PFAM
Pfam:Abhydrolase_1 501 633 3.8e-9 PFAM
Pfam:Abhydrolase_5 501 708 5e-16 PFAM
Pfam:Peptidase_S9 516 732 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159372
Predicted Effect probably benign
Transcript: ENSMUST00000160184
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161253
Predicted Effect probably benign
Transcript: ENSMUST00000161828
Predicted Effect probably benign
Transcript: ENSMUST00000162355
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably damaging
Transcript: ENSMUST00000162886
AA Change: V203A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125175
Gene: ENSMUSG00000032591
AA Change: V203A

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 1.07e-46 SMART
KR 281 363 7.94e-41 SMART
KR 368 450 6.59e-47 SMART
Tryp_SPc 479 700 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect probably benign
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193254
SMART Domains Protein: ENSMUSP00000141856
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 4.8e-8 PFAM
Pfam:Abhydrolase_5 501 708 5.7e-16 PFAM
Pfam:Abhydrolase_6 503 714 6.2e-14 PFAM
Pfam:Peptidase_S9 515 732 1.4e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains four kringle domains and a serine protease domain, similar to that found in hepatic growth factor. Despite the presence of the serine protease domain, the encoded protein may not have any proteolytic activity. The receptor for this protein is RON tyrosine kinase, which upon activation stimulates ciliary motility of ciliated epithelial lung cells. This protein is secreted and cleaved to form an alpha chain and a beta chain bridged by disulfide bonds. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lipid-filled cytoplasmic vacuoles in hepatocytes throughout the liver lobules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik A C 15: 84,417,145 V99G probably damaging Het
Abcb1b A T 5: 8,812,750 H144L probably benign Het
Adam25 A G 8: 40,754,062 N122D probably benign Het
Armc10 T C 5: 21,653,518 F187S possibly damaging Het
Best3 T A 10: 116,993,066 F84I probably damaging Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccdc60 A T 5: 116,190,094 F104I probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cd209d CAT C 8: 3,873,772 probably null Het
Cdhr4 G A 9: 107,997,397 V9M Het
Cfap46 T C 7: 139,605,644 T41A Het
Cyp2c66 A G 19: 39,170,944 T280A probably benign Het
Dis3l C T 9: 64,307,060 D1049N probably benign Het
Dlc1 T A 8: 36,938,641 probably benign Het
Faap100 T C 11: 120,374,473 T526A probably benign Het
Fam214b A G 4: 43,033,944 V444A possibly damaging Het
Gimap6 A T 6: 48,702,618 D161E probably damaging Het
Gmpr T C 13: 45,542,626 V282A possibly damaging Het
Gsap A G 5: 21,226,247 I190V possibly damaging Het
Gucy2d C T 7: 98,444,112 T232I probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lrp1 C A 10: 127,560,621 S2358I possibly damaging Het
Lrrc74a A G 12: 86,758,465 N354D probably damaging Het
Mdga2 T C 12: 66,868,752 E112G probably damaging Het
Msh6 C T 17: 87,985,767 T650I probably benign Het
Muc1 G A 3: 89,231,514 V477M possibly damaging Het
Naa11 A G 5: 97,392,207 Y31H probably damaging Het
Nphp1 G T 2: 127,763,809 H365Q possibly damaging Het
Olfr1025-ps1 G A 2: 85,917,929 M1I probably null Het
Olfr1390 A T 11: 49,341,327 Y265F probably damaging Het
Olfr409-ps1 T A 11: 74,317,160 I45N probably damaging Het
Osbpl9 A G 4: 109,102,576 F15S probably benign Het
Pcdha12 A C 18: 37,020,470 N81H probably damaging Het
Pde4d A G 13: 109,935,342 Q290R probably benign Het
Pla1a A T 16: 38,409,638 N237K probably damaging Het
Podnl1 T C 8: 84,129,327 Y239H Het
Pou4f3 G T 18: 42,395,528 D179Y possibly damaging Het
Ptch2 T C 4: 117,111,522 V995A probably damaging Het
Ptprt C T 2: 161,530,543 C1403Y probably damaging Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rspry1 A G 8: 94,623,260 E92G probably damaging Het
Sdccag8 T A 1: 176,946,237 probably benign Het
Sdk2 G A 11: 113,780,902 T2140M probably damaging Het
Serpina1e T C 12: 103,950,918 N164S probably benign Het
Tdrkh T C 3: 94,424,661 V131A probably damaging Het
Tm9sf3 T A 19: 41,256,285 N51I probably damaging Het
Trav4-3 A G 14: 53,599,305 N76D possibly damaging Het
Trhr2 T A 8: 122,358,880 I122F probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn2r99 A T 17: 19,393,660 probably benign Het
Zfp663 T C 2: 165,352,724 E525G probably damaging Het
Zfp976 C T 7: 42,613,445 E324K possibly damaging Het
Other mutations in Mst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Mst1 APN 9 108081601 missense probably benign 0.03
IGL01380:Mst1 APN 9 108084588 missense probably damaging 1.00
IGL01420:Mst1 APN 9 108082828 missense probably damaging 0.99
IGL02931:Mst1 APN 9 108084642 splice site probably null
IGL03059:Mst1 APN 9 108084813 missense probably damaging 1.00
IGL03275:Mst1 APN 9 108084388 missense possibly damaging 0.70
R0319:Mst1 UTSW 9 108082513 missense probably benign 0.05
R0361:Mst1 UTSW 9 108084897 missense probably damaging 0.98
R0412:Mst1 UTSW 9 108083594 missense probably benign 0.06
R0569:Mst1 UTSW 9 108082301 missense probably damaging 0.98
R1432:Mst1 UTSW 9 108084204 missense probably benign 0.01
R1483:Mst1 UTSW 9 108081650 missense probably benign 0.03
R1859:Mst1 UTSW 9 108084346 missense probably benign 0.23
R2187:Mst1 UTSW 9 108084340 missense possibly damaging 0.63
R2393:Mst1 UTSW 9 108082952 critical splice donor site probably null
R3522:Mst1 UTSW 9 108081503 unclassified probably benign
R3916:Mst1 UTSW 9 108084295 missense probably benign 0.00
R3917:Mst1 UTSW 9 108084295 missense probably benign 0.00
R3945:Mst1 UTSW 9 108084853 missense probably damaging 1.00
R4006:Mst1 UTSW 9 108082948 missense possibly damaging 0.52
R4007:Mst1 UTSW 9 108082948 missense possibly damaging 0.52
R4737:Mst1 UTSW 9 108080521 missense probably benign 0.00
R4756:Mst1 UTSW 9 108083627 missense probably benign 0.28
R5047:Mst1 UTSW 9 108084309 missense probably benign 0.17
R5113:Mst1 UTSW 9 108082247 missense probably damaging 1.00
R5278:Mst1 UTSW 9 108082215 missense probably damaging 0.99
R5279:Mst1 UTSW 9 108082215 missense probably damaging 0.99
R5402:Mst1 UTSW 9 108084209 critical splice donor site probably null
R5677:Mst1 UTSW 9 108081286 missense probably damaging 0.98
R5712:Mst1 UTSW 9 108082908 missense probably damaging 1.00
R6717:Mst1 UTSW 9 108080575 splice site probably null
R7059:Mst1 UTSW 9 108084064 missense probably benign 0.44
R7131:Mst1 UTSW 9 108084931 missense probably null 0.07
R7139:Mst1 UTSW 9 108082828 missense probably damaging 0.99
R7219:Mst1 UTSW 9 108081286 missense probably damaging 0.99
R7501:Mst1 UTSW 9 108082549 missense probably damaging 1.00
R7878:Mst1 UTSW 9 108084613 missense probably benign
R8304:Mst1 UTSW 9 108081604 missense probably benign
R8397:Mst1 UTSW 9 108081499 critical splice donor site probably benign
X0028:Mst1 UTSW 9 108082217 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGTGCGTTTCCAGAGCTG -3'
(R):5'- CTCAACATTCGGGTCTGTGGTG -3'

Sequencing Primer
(F):5'- GCTGTGGCATCAAAACCTG -3'
(R):5'- TTTCAGATCTTTGTCTAGGAACCTG -3'
Posted On2021-04-30