Incidental Mutation 'R8715:Sdk2'
ID 669833
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Name sidekick cell adhesion molecule 2
Synonyms 4632412F08Rik, 5330435L01Rik
MMRRC Submission 068613-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R8715 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 113667200-113957855 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 113671728 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 2140 (T2140M)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627]
AlphaFold Q6V4S5
Predicted Effect probably damaging
Transcript: ENSMUST00000041627
AA Change: T2140M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: T2140M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Meta Mutation Damage Score 0.2388 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A T 5: 8,862,750 (GRCm39) H144L probably benign Het
Adam25 A G 8: 41,207,099 (GRCm39) N122D probably benign Het
Armc10 T C 5: 21,858,516 (GRCm39) F187S possibly damaging Het
Atosb A G 4: 43,033,944 (GRCm39) V444A possibly damaging Het
Best3 T A 10: 116,828,971 (GRCm39) F84I probably damaging Het
Card11 A T 5: 140,871,315 (GRCm39) D729E probably benign Het
Ccdc60 A T 5: 116,328,153 (GRCm39) F104I probably benign Het
Ccdc88b T C 19: 6,833,213 (GRCm39) E278G probably damaging Het
Cd209d CAT C 8: 3,923,772 (GRCm39) probably null Het
Cdhr4 G A 9: 107,874,596 (GRCm39) V9M Het
Cfap46 T C 7: 139,185,560 (GRCm39) T41A Het
Cyp2c66 A G 19: 39,159,388 (GRCm39) T280A probably benign Het
Dis3l C T 9: 64,214,342 (GRCm39) D1049N probably benign Het
Dlc1 T A 8: 37,405,795 (GRCm39) probably benign Het
Faap100 T C 11: 120,265,299 (GRCm39) T526A probably benign Het
Gimap6 A T 6: 48,679,552 (GRCm39) D161E probably damaging Het
Gmpr T C 13: 45,696,102 (GRCm39) V282A possibly damaging Het
Gsap A G 5: 21,431,245 (GRCm39) I190V possibly damaging Het
Gucy2d C T 7: 98,093,319 (GRCm39) T232I probably benign Het
Lgals4 C T 7: 28,540,921 (GRCm39) R282C probably damaging Het
Lrp1 C A 10: 127,396,490 (GRCm39) S2358I possibly damaging Het
Lrrc74a A G 12: 86,805,239 (GRCm39) N354D probably damaging Het
Mdga2 T C 12: 66,915,526 (GRCm39) E112G probably damaging Het
Msh6 C T 17: 88,293,195 (GRCm39) T650I probably benign Het
Mst1 T C 9: 107,959,242 (GRCm39) V203A possibly damaging Het
Muc1 G A 3: 89,138,821 (GRCm39) V477M possibly damaging Het
Naa11 A G 5: 97,540,066 (GRCm39) Y31H probably damaging Het
Nphp1 G T 2: 127,605,729 (GRCm39) H365Q possibly damaging Het
Or1p4-ps1 T A 11: 74,207,986 (GRCm39) I45N probably damaging Het
Or2y17 A T 11: 49,232,154 (GRCm39) Y265F probably damaging Het
Or5m13 G A 2: 85,748,273 (GRCm39) M1I probably null Het
Osbpl9 A G 4: 108,959,773 (GRCm39) F15S probably benign Het
Pcdha12 A C 18: 37,153,523 (GRCm39) N81H probably damaging Het
Pde4d A G 13: 110,071,876 (GRCm39) Q290R probably benign Het
Pla1a A T 16: 38,230,000 (GRCm39) N237K probably damaging Het
Podnl1 T C 8: 84,855,956 (GRCm39) Y239H Het
Pou4f3 G T 18: 42,528,593 (GRCm39) D179Y possibly damaging Het
Ptch2 T C 4: 116,968,719 (GRCm39) V995A probably damaging Het
Ptprt C T 2: 161,372,463 (GRCm39) C1403Y probably damaging Het
Rab7 T C 6: 87,989,369 (GRCm39) S34G probably damaging Het
Rspry1 A G 8: 95,349,888 (GRCm39) E92G probably damaging Het
Sdccag8 T A 1: 176,773,803 (GRCm39) probably benign Het
Serpina1e T C 12: 103,917,177 (GRCm39) N164S probably benign Het
Shisal1 A C 15: 84,301,346 (GRCm39) V99G probably damaging Het
Tdrkh T C 3: 94,331,968 (GRCm39) V131A probably damaging Het
Tm9sf3 T A 19: 41,244,724 (GRCm39) N51I probably damaging Het
Trav4-3 A G 14: 53,836,762 (GRCm39) N76D possibly damaging Het
Trhr2 T A 8: 123,085,619 (GRCm39) I122F probably damaging Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Vmn2r99 A T 17: 19,613,922 (GRCm39) probably benign Het
Zfp663 T C 2: 165,194,644 (GRCm39) E525G probably damaging Het
Zfp976 C T 7: 42,262,869 (GRCm39) E324K possibly damaging Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113,745,210 (GRCm39) missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113,721,668 (GRCm39) missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113,733,906 (GRCm39) missense probably benign
IGL01316:Sdk2 APN 11 113,758,791 (GRCm39) missense probably benign 0.09
IGL01614:Sdk2 APN 11 113,684,684 (GRCm39) missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113,729,358 (GRCm39) missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113,729,320 (GRCm39) missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113,725,656 (GRCm39) missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113,725,639 (GRCm39) splice site probably benign
IGL02543:Sdk2 APN 11 113,759,747 (GRCm39) missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113,742,668 (GRCm39) missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113,712,452 (GRCm39) missense probably benign 0.00
IGL03122:Sdk2 APN 11 113,732,894 (GRCm39) missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113,741,810 (GRCm39) missense probably benign 0.19
IGL03222:Sdk2 APN 11 113,729,257 (GRCm39) missense probably benign 0.01
IGL03310:Sdk2 APN 11 113,684,151 (GRCm39) missense possibly damaging 0.77
Curtailed UTSW 11 113,742,626 (GRCm39) missense probably damaging 1.00
Trimmed UTSW 11 113,747,522 (GRCm39) nonsense probably null
ANU05:Sdk2 UTSW 11 113,733,906 (GRCm39) missense probably benign
BB008:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
BB018:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
R0008:Sdk2 UTSW 11 113,747,581 (GRCm39) missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113,747,581 (GRCm39) missense probably damaging 1.00
R0088:Sdk2 UTSW 11 113,717,912 (GRCm39) missense possibly damaging 0.74
R0096:Sdk2 UTSW 11 113,793,970 (GRCm39) splice site probably benign
R0386:Sdk2 UTSW 11 113,784,290 (GRCm39) missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113,720,793 (GRCm39) missense probably benign 0.04
R0409:Sdk2 UTSW 11 113,741,717 (GRCm39) splice site probably benign
R0416:Sdk2 UTSW 11 113,694,029 (GRCm39) missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113,682,292 (GRCm39) missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113,671,836 (GRCm39) missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113,685,746 (GRCm39) splice site probably null
R0711:Sdk2 UTSW 11 113,793,970 (GRCm39) splice site probably benign
R0717:Sdk2 UTSW 11 113,723,152 (GRCm39) missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113,784,334 (GRCm39) missense probably benign 0.07
R0831:Sdk2 UTSW 11 113,723,084 (GRCm39) missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113,712,241 (GRCm39) missense probably benign 0.00
R0865:Sdk2 UTSW 11 113,741,748 (GRCm39) missense probably benign 0.12
R0930:Sdk2 UTSW 11 113,729,271 (GRCm39) missense probably benign 0.01
R0964:Sdk2 UTSW 11 113,697,243 (GRCm39) splice site probably benign
R1051:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1052:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1054:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1055:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1077:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1079:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1115:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1186:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1187:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1337:Sdk2 UTSW 11 113,723,157 (GRCm39) missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1433:Sdk2 UTSW 11 113,685,871 (GRCm39) missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113,720,906 (GRCm39) missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113,720,906 (GRCm39) missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113,784,401 (GRCm39) splice site probably benign
R1514:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1529:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1596:Sdk2 UTSW 11 113,729,435 (GRCm39) splice site probably benign
R1680:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1680:Sdk2 UTSW 11 113,682,262 (GRCm39) missense possibly damaging 0.47
R1770:Sdk2 UTSW 11 113,684,567 (GRCm39) missense probably benign 0.05
R1858:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1866:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1874:Sdk2 UTSW 11 113,725,782 (GRCm39) missense probably benign 0.00
R1899:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1905:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1907:Sdk2 UTSW 11 113,729,472 (GRCm39) synonymous silent
R1913:Sdk2 UTSW 11 113,747,552 (GRCm39) missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113,671,843 (GRCm39) nonsense probably null
R2055:Sdk2 UTSW 11 113,741,780 (GRCm39) missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113,745,158 (GRCm39) missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113,833,948 (GRCm39) missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113,721,620 (GRCm39) missense probably benign 0.44
R3720:Sdk2 UTSW 11 113,691,070 (GRCm39) missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113,747,522 (GRCm39) nonsense probably null
R4037:Sdk2 UTSW 11 113,685,881 (GRCm39) missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113,757,815 (GRCm39) splice site probably null
R4717:Sdk2 UTSW 11 113,745,195 (GRCm39) missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113,717,880 (GRCm39) missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113,712,208 (GRCm39) nonsense probably null
R4924:Sdk2 UTSW 11 113,748,584 (GRCm39) missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113,684,587 (GRCm39) missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113,741,808 (GRCm39) missense probably benign 0.01
R5239:Sdk2 UTSW 11 113,758,859 (GRCm39) missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113,715,912 (GRCm39) missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113,757,857 (GRCm39) missense probably benign 0.31
R5535:Sdk2 UTSW 11 113,833,984 (GRCm39) missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113,742,540 (GRCm39) missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113,724,005 (GRCm39) missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113,742,626 (GRCm39) missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113,759,778 (GRCm39) missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113,717,942 (GRCm39) missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113,745,099 (GRCm39) missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113,725,810 (GRCm39) missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113,742,708 (GRCm39) missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113,720,885 (GRCm39) missense probably benign 0.00
R5953:Sdk2 UTSW 11 113,684,570 (GRCm39) missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113,834,080 (GRCm39) missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113,720,889 (GRCm39) missense probably benign 0.00
R6116:Sdk2 UTSW 11 113,745,190 (GRCm39) missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113,684,581 (GRCm39) missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113,784,334 (GRCm39) missense probably benign 0.07
R6383:Sdk2 UTSW 11 113,723,091 (GRCm39) missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113,758,760 (GRCm39) missense probably benign 0.43
R6835:Sdk2 UTSW 11 113,720,874 (GRCm39) missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113,671,755 (GRCm39) missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113,793,946 (GRCm39) missense probably benign 0.03
R7000:Sdk2 UTSW 11 113,693,995 (GRCm39) missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113,725,731 (GRCm39) missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113,733,516 (GRCm39) nonsense probably null
R7177:Sdk2 UTSW 11 113,720,795 (GRCm39) missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113,729,315 (GRCm39) missense probably damaging 0.98
R7412:Sdk2 UTSW 11 113,758,909 (GRCm39) splice site probably null
R7504:Sdk2 UTSW 11 113,758,793 (GRCm39) missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113,764,039 (GRCm39) missense possibly damaging 0.63
R7604:Sdk2 UTSW 11 113,720,795 (GRCm39) missense possibly damaging 0.91
R7647:Sdk2 UTSW 11 113,684,563 (GRCm39) missense probably damaging 1.00
R7897:Sdk2 UTSW 11 113,764,027 (GRCm39) missense possibly damaging 0.50
R7931:Sdk2 UTSW 11 113,784,267 (GRCm39) missense possibly damaging 0.79
R7998:Sdk2 UTSW 11 113,750,764 (GRCm39) missense probably benign 0.18
R8052:Sdk2 UTSW 11 113,745,177 (GRCm39) missense probably damaging 1.00
R8053:Sdk2 UTSW 11 113,745,177 (GRCm39) missense probably damaging 1.00
R8084:Sdk2 UTSW 11 113,717,915 (GRCm39) missense possibly damaging 0.67
R8136:Sdk2 UTSW 11 113,742,539 (GRCm39) missense probably damaging 1.00
R8151:Sdk2 UTSW 11 113,763,683 (GRCm39) missense possibly damaging 0.84
R8394:Sdk2 UTSW 11 113,729,542 (GRCm39) missense probably benign
R8774:Sdk2 UTSW 11 113,730,169 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Sdk2 UTSW 11 113,730,169 (GRCm39) missense probably damaging 1.00
R8804:Sdk2 UTSW 11 113,763,978 (GRCm39) nonsense probably null
R9136:Sdk2 UTSW 11 113,697,203 (GRCm39) missense probably damaging 1.00
R9147:Sdk2 UTSW 11 113,714,226 (GRCm39) missense probably benign 0.18
R9300:Sdk2 UTSW 11 113,715,856 (GRCm39) missense possibly damaging 0.63
R9354:Sdk2 UTSW 11 113,725,757 (GRCm39) missense probably benign 0.00
R9450:Sdk2 UTSW 11 113,697,105 (GRCm39) missense probably benign
R9462:Sdk2 UTSW 11 113,760,744 (GRCm39) missense possibly damaging 0.56
R9616:Sdk2 UTSW 11 113,691,061 (GRCm39) missense probably benign 0.05
R9678:Sdk2 UTSW 11 113,685,789 (GRCm39) nonsense probably null
RF002:Sdk2 UTSW 11 113,776,078 (GRCm39) missense probably benign 0.00
V1662:Sdk2 UTSW 11 113,725,734 (GRCm39) missense probably damaging 1.00
Z1176:Sdk2 UTSW 11 113,742,662 (GRCm39) missense probably damaging 0.97
Z1176:Sdk2 UTSW 11 113,730,148 (GRCm39) missense probably benign 0.41
Z1177:Sdk2 UTSW 11 113,750,782 (GRCm39) missense probably benign
Z1177:Sdk2 UTSW 11 113,730,146 (GRCm39) missense probably damaging 1.00
Z1177:Sdk2 UTSW 11 113,729,485 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTTGGGAGGTGAAACGTTG -3'
(R):5'- CCAGAAAGCCCACTCCTTTG -3'

Sequencing Primer
(F):5'- AGGTGAAACGTTGAGTCGATGTC -3'
(R):5'- TTGTCAACCATTACATCAGTGACC -3'
Posted On 2021-04-30