Incidental Mutation 'R8715:Mdga2'
ID669835
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 2
SynonymsAdp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8715 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location66466060-67222549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66868752 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 112 (E112G)
Ref Sequence ENSEMBL: ENSMUSP00000046761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]
Predicted Effect probably damaging
Transcript: ENSMUST00000037181
AA Change: E112G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: E112G

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000101379
AA Change: E96G
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912
AA Change: E96G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000178814
AA Change: E102G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: E102G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222167
AA Change: E43G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223141
AA Change: E43G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik A C 15: 84,417,145 V99G probably damaging Het
Abcb1b A T 5: 8,812,750 H144L probably benign Het
Adam25 A G 8: 40,754,062 N122D probably benign Het
Armc10 T C 5: 21,653,518 F187S possibly damaging Het
Best3 T A 10: 116,993,066 F84I probably damaging Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccdc60 A T 5: 116,190,094 F104I probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cd209d CAT C 8: 3,873,772 probably null Het
Cdhr4 G A 9: 107,997,397 V9M Het
Cfap46 T C 7: 139,605,644 T41A Het
Cyp2c66 A G 19: 39,170,944 T280A probably benign Het
Dis3l C T 9: 64,307,060 D1049N probably benign Het
Dlc1 T A 8: 36,938,641 probably benign Het
Faap100 T C 11: 120,374,473 T526A probably benign Het
Fam214b A G 4: 43,033,944 V444A possibly damaging Het
Gimap6 A T 6: 48,702,618 D161E probably damaging Het
Gmpr T C 13: 45,542,626 V282A possibly damaging Het
Gsap A G 5: 21,226,247 I190V possibly damaging Het
Gucy2d C T 7: 98,444,112 T232I probably benign Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lrp1 C A 10: 127,560,621 S2358I possibly damaging Het
Lrrc74a A G 12: 86,758,465 N354D probably damaging Het
Msh6 C T 17: 87,985,767 T650I probably benign Het
Mst1 T C 9: 108,082,043 V203A possibly damaging Het
Muc1 G A 3: 89,231,514 V477M possibly damaging Het
Naa11 A G 5: 97,392,207 Y31H probably damaging Het
Nphp1 G T 2: 127,763,809 H365Q possibly damaging Het
Olfr1025-ps1 G A 2: 85,917,929 M1I probably null Het
Olfr1390 A T 11: 49,341,327 Y265F probably damaging Het
Olfr409-ps1 T A 11: 74,317,160 I45N probably damaging Het
Osbpl9 A G 4: 109,102,576 F15S probably benign Het
Pcdha12 A C 18: 37,020,470 N81H probably damaging Het
Pde4d A G 13: 109,935,342 Q290R probably benign Het
Pla1a A T 16: 38,409,638 N237K probably damaging Het
Podnl1 T C 8: 84,129,327 Y239H Het
Pou4f3 G T 18: 42,395,528 D179Y possibly damaging Het
Ptch2 T C 4: 117,111,522 V995A probably damaging Het
Ptprt C T 2: 161,530,543 C1403Y probably damaging Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rspry1 A G 8: 94,623,260 E92G probably damaging Het
Sdccag8 T A 1: 176,946,237 probably benign Het
Sdk2 G A 11: 113,780,902 T2140M probably damaging Het
Serpina1e T C 12: 103,950,918 N164S probably benign Het
Tdrkh T C 3: 94,424,661 V131A probably damaging Het
Tm9sf3 T A 19: 41,256,285 N51I probably damaging Het
Trav4-3 A G 14: 53,599,305 N76D possibly damaging Het
Trhr2 T A 8: 122,358,880 I122F probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Vmn2r99 A T 17: 19,393,660 probably benign Het
Zfp663 T C 2: 165,352,724 E525G probably damaging Het
Zfp976 C T 7: 42,613,445 E324K possibly damaging Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66486733 missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66723120 missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1521:Mdga2 UTSW 12 66568926 missense probably benign 0.00
R1556:Mdga2 UTSW 12 66550593 missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66486708 splice site probably benign
R2069:Mdga2 UTSW 12 66568917 nonsense probably null
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4437:Mdga2 UTSW 12 66473198 splice site probably null
R4514:Mdga2 UTSW 12 66716722 missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66486741 missense probably benign 0.43
R5479:Mdga2 UTSW 12 66655176 missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66506253 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R6971:Mdga2 UTSW 12 66550561 missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
R7559:Mdga2 UTSW 12 66473229 missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66506255 missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66506123 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689350 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689351 missense possibly damaging 0.63
R7852:Mdga2 UTSW 12 66470950 missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66655263 missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67221029 missense unknown
Z1176:Mdga2 UTSW 12 66689443 missense probably damaging 1.00
Z1186:Mdga2 UTSW 12 66568953 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CGGAAGTGTATTCTCAATTTCTCACAG -3'
(R):5'- CAAGTACAAAGTGTTGGGTCTGC -3'

Sequencing Primer
(F):5'- CATTCTTCATGTACATTGTAGTTGC -3'
(R):5'- GCTATGGTGGAGTCTCTAAGAATTAG -3'
Posted On2021-04-30