Incidental Mutation 'R8716:Olfr1215'
ID669853
Institutional Source Beutler Lab
Gene Symbol Olfr1215
Ensembl Gene ENSMUSG00000100016
Gene Nameolfactory receptor 1215
SynonymsGA_x6K02T2Q125-50482823-50481885, MOR233-13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R8716 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89000021-89006973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89001716 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 191 (T191A)
Ref Sequence ENSEMBL: ENSMUSP00000150030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000188399] [ENSMUST00000214809] [ENSMUST00000216271]
Predicted Effect
SMART Domains Protein: ENSMUSP00000141134
Gene: ENSMUSG00000100016
AA Change: T191A

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
Pfam:7tm_1 39 286 1.9e-25 PFAM
Pfam:7tm_4 138 283 1.7e-38 PFAM
Predicted Effect
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,774 Y1879C probably benign Het
Abce1 A T 8: 79,701,155 I168N possibly damaging Het
Acan G A 7: 79,112,690 R2004H probably damaging Het
Acsm4 T A 7: 119,708,660 L340Q probably damaging Het
Adamts2 T A 11: 50,773,264 N342K probably damaging Het
Adgrd1 A T 5: 129,188,371 D725V possibly damaging Het
Ahnak T A 19: 9,009,074 L2574Q probably damaging Het
Ank2 A T 3: 126,942,839 L3132* probably null Het
Ap3b2 T G 7: 81,477,153 E283A probably benign Het
Asb17 A T 3: 153,853,514 L287F probably damaging Het
Atr T G 9: 95,907,415 N1541K probably benign Het
BC024978 C A 7: 27,197,206 P65T probably damaging Het
Bcas3 G A 11: 85,581,042 V711I probably damaging Het
Ccdc82 T G 9: 13,253,297 Y262* probably null Het
Cd209d CAT C 8: 3,873,772 probably null Het
Cdc23 GAGACTACCGAAGA GAGA 18: 34,651,682 probably null Het
Cfap54 T A 10: 92,964,632 L1571F probably benign Het
Clca3b C T 3: 144,844,594 V197I probably benign Het
Cul9 T C 17: 46,527,914 S932G probably benign Het
Cyp3a59 T A 5: 146,096,601 D182E probably damaging Het
Ddx19a T C 8: 110,983,611 E119G probably damaging Het
Dnah1 A G 14: 31,267,984 probably benign Het
Dopey2 T A 16: 93,780,785 L1761* probably null Het
Ehd2 A G 7: 15,964,181 S44P probably benign Het
Exoc2 T A 13: 30,911,244 H223L probably damaging Het
Fam217a G A 13: 34,924,265 probably benign Het
Farp1 A G 14: 121,242,443 N382S probably benign Het
Gbf1 T A 19: 46,284,021 L1633Q probably damaging Het
Gpn1 C T 5: 31,499,298 T115I probably benign Het
Gstcd T C 3: 132,983,189 D600G probably damaging Het
Ighv16-1 A C 12: 114,068,996 M62R probably benign Het
Igsf3 T G 3: 101,427,423 V272G probably damaging Het
Itgb2 T C 10: 77,557,953 V409A probably damaging Het
Kcnh8 C T 17: 52,977,752 P917S probably benign Het
Kif23 T C 9: 61,937,195 T114A probably damaging Het
Krt35 A G 11: 100,096,185 M1T probably null Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lonp2 T C 8: 86,716,305 I798T probably benign Het
Lrp2 T A 2: 69,443,794 T3971S probably benign Het
Mcc C A 18: 44,449,336 V758F possibly damaging Het
Naip2 C T 13: 100,144,406 V1433I probably benign Het
Ndfip1 T C 18: 38,452,331 F133L probably damaging Het
Nlrc4 T A 17: 74,445,990 E466V probably damaging Het
Nwd1 A G 8: 72,662,280 D112G probably damaging Het
Olfr1495 T C 19: 13,768,821 S160P probably damaging Het
Olfr859 C T 9: 19,808,869 L184F probably damaging Het
Olfr94 C T 17: 37,197,408 V112M possibly damaging Het
Opn4 G T 14: 34,593,862 R405S probably benign Het
Oraov1 G T 7: 144,915,193 probably benign Het
Pde11a T A 2: 76,017,894 D863V probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekhf1 A T 7: 38,221,898 L82Q probably damaging Het
Pou4f3 G T 18: 42,395,528 D179Y possibly damaging Het
Ppp1r12a G A 10: 108,260,888 R713H probably damaging Het
Psg17 C A 7: 18,821,385 G11W probably benign Het
Ptprh A T 7: 4,564,274 V533D probably damaging Het
Ptprn2 A G 12: 117,255,548 D933G possibly damaging Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rfx6 A C 10: 51,681,872 H147P probably damaging Het
Rprd2 T C 3: 95,776,793 Y310C probably damaging Het
Samd11 A G 4: 156,249,270 F201S probably benign Het
Sox7 A G 14: 63,948,588 T358A probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tie1 G A 4: 118,482,738 T364M possibly damaging Het
Ttn C A 2: 76,766,922 L19882F probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ubr4 T C 4: 139,468,853 W1267R unknown Het
Usp42 G A 5: 143,717,941 P456S probably damaging Het
Vmn1r235 T C 17: 21,262,292 V293A possibly damaging Het
Vmn2r90 T A 17: 17,704,081 H47Q probably damaging Het
Vps13d T A 4: 145,075,778 T3503S Het
Vwa5b2 T A 16: 20,596,276 N349K probably benign Het
Zeb1 A T 18: 5,767,958 Y823F probably damaging Het
Zfp273 T A 13: 67,825,934 C394S probably damaging Het
Zfp286 G T 11: 62,780,991 A147D unknown Het
Zfp831 A G 2: 174,705,256 T1411A possibly damaging Het
Other mutations in Olfr1215
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Olfr1215 APN 2 89001339 utr 3 prime probably benign
IGL02395:Olfr1215 APN 2 89002163 missense probably benign 0.00
IGL02399:Olfr1215 APN 2 89002163 missense probably benign 0.00
IGL02409:Olfr1215 APN 2 89001910 missense possibly damaging 0.75
IGL02421:Olfr1215 APN 2 89001344 splice site probably null
IGL03036:Olfr1215 APN 2 89002115 missense possibly damaging 0.94
R2036:Olfr1215 UTSW 2 89001632 missense probably damaging 0.97
R2199:Olfr1215 UTSW 2 89001550 missense probably damaging 0.98
R3930:Olfr1215 UTSW 2 89002033 missense probably benign 0.32
R4990:Olfr1215 UTSW 2 89001472 missense probably damaging 0.97
R5199:Olfr1215 UTSW 2 89001763 missense possibly damaging 0.70
R5368:Olfr1215 UTSW 2 89002091 missense probably damaging 1.00
R5396:Olfr1215 UTSW 2 89002196 missense probably benign 0.15
R6881:Olfr1215 UTSW 2 89001937 missense probably damaging 1.00
R7195:Olfr1215 UTSW 2 89001731 missense
R7425:Olfr1215 UTSW 2 89002200 missense
R7804:Olfr1215 UTSW 2 89001511 missense unknown
R7976:Olfr1215 UTSW 2 89001629 missense probably damaging 0.97
R8094:Olfr1215 UTSW 2 89002368 start gained probably benign
R8737:Olfr1215 UTSW 2 89002007 nonsense probably null
Z1088:Olfr1215 UTSW 2 89001838 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CACAACAGTAATGTGGGACCC -3'
(R):5'- GGAGGTGATCATTCTGGCAG -3'

Sequencing Primer
(F):5'- CACAGGTAGAGAGAGCTTTACGTCTC -3'
(R):5'- ACCGGTATGTAGCCATTTGTAAGC -3'
Posted On2021-04-30