Incidental Mutation 'R8716:Rprd2'
ID669855
Institutional Source Beutler Lab
Gene Symbol Rprd2
Ensembl Gene ENSMUSG00000028106
Gene Nameregulation of nuclear pre-mRNA domain containing 2
Synonyms6720469I21Rik, 2810036A19Rik, 4930535B03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.699) question?
Stock #R8716 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location95760341-95818863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95776793 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 310 (Y310C)
Ref Sequence ENSEMBL: ENSMUSP00000088297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090791] [ENSMUST00000197449]
Predicted Effect probably damaging
Transcript: ENSMUST00000090791
AA Change: Y310C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088297
Gene: ENSMUSG00000028106
AA Change: Y310C

DomainStartEndE-ValueType
RPR 26 146 3.6e-29 SMART
Pfam:CREPT 210 351 9.3e-11 PFAM
low complexity region 431 465 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
low complexity region 612 633 N/A INTRINSIC
low complexity region 670 686 N/A INTRINSIC
low complexity region 777 793 N/A INTRINSIC
low complexity region 1159 1179 N/A INTRINSIC
low complexity region 1195 1208 N/A INTRINSIC
low complexity region 1230 1238 N/A INTRINSIC
low complexity region 1272 1295 N/A INTRINSIC
low complexity region 1300 1323 N/A INTRINSIC
low complexity region 1373 1409 N/A INTRINSIC
low complexity region 1446 1467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197449
AA Change: Y292C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143240
Gene: ENSMUSG00000028106
AA Change: Y292C

DomainStartEndE-ValueType
RPR 26 146 3.2e-32 SMART
coiled coil region 288 313 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 413 447 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,774 Y1879C probably benign Het
Abce1 A T 8: 79,701,155 I168N possibly damaging Het
Acan G A 7: 79,112,690 R2004H probably damaging Het
Acsm4 T A 7: 119,708,660 L340Q probably damaging Het
Adamts2 T A 11: 50,773,264 N342K probably damaging Het
Adgrd1 A T 5: 129,188,371 D725V possibly damaging Het
Ahnak T A 19: 9,009,074 L2574Q probably damaging Het
Ank2 A T 3: 126,942,839 L3132* probably null Het
Ap3b2 T G 7: 81,477,153 E283A probably benign Het
Asb17 A T 3: 153,853,514 L287F probably damaging Het
Atr T G 9: 95,907,415 N1541K probably benign Het
BC024978 C A 7: 27,197,206 P65T probably damaging Het
Bcas3 G A 11: 85,581,042 V711I probably damaging Het
Ccdc82 T G 9: 13,253,297 Y262* probably null Het
Cd209d CAT C 8: 3,873,772 probably null Het
Cdc23 GAGACTACCGAAGA GAGA 18: 34,651,682 probably null Het
Cfap54 T A 10: 92,964,632 L1571F probably benign Het
Clca3b C T 3: 144,844,594 V197I probably benign Het
Cul9 T C 17: 46,527,914 S932G probably benign Het
Cyp3a59 T A 5: 146,096,601 D182E probably damaging Het
Ddx19a T C 8: 110,983,611 E119G probably damaging Het
Dnah1 A G 14: 31,267,984 probably benign Het
Dopey2 T A 16: 93,780,785 L1761* probably null Het
Ehd2 A G 7: 15,964,181 S44P probably benign Het
Exoc2 T A 13: 30,911,244 H223L probably damaging Het
Fam217a G A 13: 34,924,265 probably benign Het
Farp1 A G 14: 121,242,443 N382S probably benign Het
Gbf1 T A 19: 46,284,021 L1633Q probably damaging Het
Gpn1 C T 5: 31,499,298 T115I probably benign Het
Gstcd T C 3: 132,983,189 D600G probably damaging Het
Ighv16-1 A C 12: 114,068,996 M62R probably benign Het
Igsf3 T G 3: 101,427,423 V272G probably damaging Het
Itgb2 T C 10: 77,557,953 V409A probably damaging Het
Kcnh8 C T 17: 52,977,752 P917S probably benign Het
Kif23 T C 9: 61,937,195 T114A probably damaging Het
Krt35 A G 11: 100,096,185 M1T probably null Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lonp2 T C 8: 86,716,305 I798T probably benign Het
Lrp2 T A 2: 69,443,794 T3971S probably benign Het
Mcc C A 18: 44,449,336 V758F possibly damaging Het
Naip2 C T 13: 100,144,406 V1433I probably benign Het
Ndfip1 T C 18: 38,452,331 F133L probably damaging Het
Nlrc4 T A 17: 74,445,990 E466V probably damaging Het
Nwd1 A G 8: 72,662,280 D112G probably damaging Het
Olfr1215 T C 2: 89,001,716 T191A Het
Olfr1495 T C 19: 13,768,821 S160P probably damaging Het
Olfr859 C T 9: 19,808,869 L184F probably damaging Het
Olfr94 C T 17: 37,197,408 V112M possibly damaging Het
Opn4 G T 14: 34,593,862 R405S probably benign Het
Oraov1 G T 7: 144,915,193 probably benign Het
Pde11a T A 2: 76,017,894 D863V probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekhf1 A T 7: 38,221,898 L82Q probably damaging Het
Pou4f3 G T 18: 42,395,528 D179Y possibly damaging Het
Ppp1r12a G A 10: 108,260,888 R713H probably damaging Het
Psg17 C A 7: 18,821,385 G11W probably benign Het
Ptprh A T 7: 4,564,274 V533D probably damaging Het
Ptprn2 A G 12: 117,255,548 D933G possibly damaging Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rfx6 A C 10: 51,681,872 H147P probably damaging Het
Samd11 A G 4: 156,249,270 F201S probably benign Het
Sox7 A G 14: 63,948,588 T358A probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tie1 G A 4: 118,482,738 T364M possibly damaging Het
Ttn C A 2: 76,766,922 L19882F probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ubr4 T C 4: 139,468,853 W1267R unknown Het
Usp42 G A 5: 143,717,941 P456S probably damaging Het
Vmn1r235 T C 17: 21,262,292 V293A possibly damaging Het
Vmn2r90 T A 17: 17,704,081 H47Q probably damaging Het
Vps13d T A 4: 145,075,778 T3503S Het
Vwa5b2 T A 16: 20,596,276 N349K probably benign Het
Zeb1 A T 18: 5,767,958 Y823F probably damaging Het
Zfp273 T A 13: 67,825,934 C394S probably damaging Het
Zfp286 G T 11: 62,780,991 A147D unknown Het
Zfp831 A G 2: 174,705,256 T1411A possibly damaging Het
Other mutations in Rprd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Rprd2 APN 3 95765379 missense possibly damaging 0.95
IGL00773:Rprd2 APN 3 95765109 missense probably damaging 1.00
IGL00792:Rprd2 APN 3 95785104 missense probably benign 0.05
IGL01022:Rprd2 APN 3 95763754 nonsense probably null
IGL01121:Rprd2 APN 3 95776550 missense probably damaging 1.00
IGL01299:Rprd2 APN 3 95776547 missense probably damaging 1.00
IGL01387:Rprd2 APN 3 95765319 missense probably benign
IGL01414:Rprd2 APN 3 95765525 missense probably damaging 1.00
IGL02283:Rprd2 APN 3 95765503 missense probably damaging 0.98
IGL02336:Rprd2 APN 3 95787310 missense probably benign 0.17
R0131:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0131:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0132:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0574:Rprd2 UTSW 3 95774357 missense possibly damaging 0.58
R0718:Rprd2 UTSW 3 95766387 missense probably benign 0.30
R0847:Rprd2 UTSW 3 95765413 missense probably benign 0.00
R0942:Rprd2 UTSW 3 95765418 missense probably damaging 1.00
R0943:Rprd2 UTSW 3 95784247 missense possibly damaging 0.88
R0980:Rprd2 UTSW 3 95765904 missense probably damaging 1.00
R1448:Rprd2 UTSW 3 95818576 missense possibly damaging 0.57
R1542:Rprd2 UTSW 3 95765676 missense possibly damaging 0.69
R1577:Rprd2 UTSW 3 95764735 missense probably damaging 1.00
R1598:Rprd2 UTSW 3 95818739 unclassified probably benign
R1640:Rprd2 UTSW 3 95763747 unclassified probably benign
R1670:Rprd2 UTSW 3 95764803 missense probably damaging 1.00
R2430:Rprd2 UTSW 3 95764795 nonsense probably null
R2966:Rprd2 UTSW 3 95766433 splice site probably null
R3612:Rprd2 UTSW 3 95764152 missense probably damaging 0.98
R3712:Rprd2 UTSW 3 95764560 missense probably damaging 0.97
R3890:Rprd2 UTSW 3 95765224 missense probably damaging 1.00
R4777:Rprd2 UTSW 3 95787374 missense probably benign 0.41
R4783:Rprd2 UTSW 3 95774333 missense probably benign 0.03
R4832:Rprd2 UTSW 3 95774171 missense probably damaging 1.00
R4928:Rprd2 UTSW 3 95764537 missense probably damaging 1.00
R4976:Rprd2 UTSW 3 95766349 missense probably damaging 1.00
R4989:Rprd2 UTSW 3 95765320 missense probably benign 0.03
R5134:Rprd2 UTSW 3 95765320 missense probably benign 0.03
R5244:Rprd2 UTSW 3 95790182 missense possibly damaging 0.80
R5314:Rprd2 UTSW 3 95764089 missense possibly damaging 0.53
R5579:Rprd2 UTSW 3 95785059 missense probably damaging 1.00
R5954:Rprd2 UTSW 3 95764863 missense probably damaging 1.00
R6016:Rprd2 UTSW 3 95787373 missense probably damaging 0.97
R6332:Rprd2 UTSW 3 95780441 missense probably damaging 0.99
R6403:Rprd2 UTSW 3 95766087 missense possibly damaging 0.77
R6415:Rprd2 UTSW 3 95774219 missense probably benign 0.00
R7064:Rprd2 UTSW 3 95765016 missense probably damaging 1.00
R7313:Rprd2 UTSW 3 95776710 missense probably damaging 1.00
R7496:Rprd2 UTSW 3 95765775 missense probably damaging 1.00
R7535:Rprd2 UTSW 3 95776587 missense probably damaging 0.96
R8822:Rprd2 UTSW 3 95784301 missense probably damaging 1.00
R8891:Rprd2 UTSW 3 95764055 missense possibly damaging 0.85
R8922:Rprd2 UTSW 3 95780584 missense probably damaging 0.99
RF034:Rprd2 UTSW 3 95766320 small deletion probably benign
RF056:Rprd2 UTSW 3 95766319 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGACTTGTCACTCTCCATGGC -3'
(R):5'- AGTATTCACTGAGCAGTAGATGCC -3'

Sequencing Primer
(F):5'- CCGGTGACTGGGGTTCTTCAC -3'
(R):5'- CAAGGCTGCTCTGTGCTCTG -3'
Posted On2021-04-30