Incidental Mutation 'R8716:Clca3b'
ID669859
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Namechloride channel accessory 3B
SynonymsClca4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8716 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location144822623-144849357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 144844594 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 197 (V197I)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
Predicted Effect probably benign
Transcript: ENSMUST00000159989
AA Change: V197I

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: V197I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,774 Y1879C probably benign Het
Abce1 A T 8: 79,701,155 I168N possibly damaging Het
Acan G A 7: 79,112,690 R2004H probably damaging Het
Acsm4 T A 7: 119,708,660 L340Q probably damaging Het
Adamts2 T A 11: 50,773,264 N342K probably damaging Het
Adgrd1 A T 5: 129,188,371 D725V possibly damaging Het
Ahnak T A 19: 9,009,074 L2574Q probably damaging Het
Ank2 A T 3: 126,942,839 L3132* probably null Het
Ap3b2 T G 7: 81,477,153 E283A probably benign Het
Asb17 A T 3: 153,853,514 L287F probably damaging Het
Atr T G 9: 95,907,415 N1541K probably benign Het
BC024978 C A 7: 27,197,206 P65T probably damaging Het
Bcas3 G A 11: 85,581,042 V711I probably damaging Het
Ccdc82 T G 9: 13,253,297 Y262* probably null Het
Cd209d CAT C 8: 3,873,772 probably null Het
Cdc23 GAGACTACCGAAGA GAGA 18: 34,651,682 probably null Het
Cfap54 T A 10: 92,964,632 L1571F probably benign Het
Cul9 T C 17: 46,527,914 S932G probably benign Het
Cyp3a59 T A 5: 146,096,601 D182E probably damaging Het
Ddx19a T C 8: 110,983,611 E119G probably damaging Het
Dnah1 A G 14: 31,267,984 probably benign Het
Dopey2 T A 16: 93,780,785 L1761* probably null Het
Ehd2 A G 7: 15,964,181 S44P probably benign Het
Exoc2 T A 13: 30,911,244 H223L probably damaging Het
Fam217a G A 13: 34,924,265 probably benign Het
Farp1 A G 14: 121,242,443 N382S probably benign Het
Gbf1 T A 19: 46,284,021 L1633Q probably damaging Het
Gpn1 C T 5: 31,499,298 T115I probably benign Het
Gstcd T C 3: 132,983,189 D600G probably damaging Het
Ighv16-1 A C 12: 114,068,996 M62R probably benign Het
Igsf3 T G 3: 101,427,423 V272G probably damaging Het
Itgb2 T C 10: 77,557,953 V409A probably damaging Het
Kcnh8 C T 17: 52,977,752 P917S probably benign Het
Kif23 T C 9: 61,937,195 T114A probably damaging Het
Krt35 A G 11: 100,096,185 M1T probably null Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lonp2 T C 8: 86,716,305 I798T probably benign Het
Lrp2 T A 2: 69,443,794 T3971S probably benign Het
Mcc C A 18: 44,449,336 V758F possibly damaging Het
Naip2 C T 13: 100,144,406 V1433I probably benign Het
Ndfip1 T C 18: 38,452,331 F133L probably damaging Het
Nlrc4 T A 17: 74,445,990 E466V probably damaging Het
Nwd1 A G 8: 72,662,280 D112G probably damaging Het
Olfr1215 T C 2: 89,001,716 T191A Het
Olfr1495 T C 19: 13,768,821 S160P probably damaging Het
Olfr859 C T 9: 19,808,869 L184F probably damaging Het
Olfr94 C T 17: 37,197,408 V112M possibly damaging Het
Opn4 G T 14: 34,593,862 R405S probably benign Het
Oraov1 G T 7: 144,915,193 probably benign Het
Pde11a T A 2: 76,017,894 D863V probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekhf1 A T 7: 38,221,898 L82Q probably damaging Het
Pou4f3 G T 18: 42,395,528 D179Y possibly damaging Het
Ppp1r12a G A 10: 108,260,888 R713H probably damaging Het
Psg17 C A 7: 18,821,385 G11W probably benign Het
Ptprh A T 7: 4,564,274 V533D probably damaging Het
Ptprn2 A G 12: 117,255,548 D933G possibly damaging Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rfx6 A C 10: 51,681,872 H147P probably damaging Het
Rprd2 T C 3: 95,776,793 Y310C probably damaging Het
Samd11 A G 4: 156,249,270 F201S probably benign Het
Sox7 A G 14: 63,948,588 T358A probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tie1 G A 4: 118,482,738 T364M possibly damaging Het
Ttn C A 2: 76,766,922 L19882F probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ubr4 T C 4: 139,468,853 W1267R unknown Het
Usp42 G A 5: 143,717,941 P456S probably damaging Het
Vmn1r235 T C 17: 21,262,292 V293A possibly damaging Het
Vmn2r90 T A 17: 17,704,081 H47Q probably damaging Het
Vps13d T A 4: 145,075,778 T3503S Het
Vwa5b2 T A 16: 20,596,276 N349K probably benign Het
Zeb1 A T 18: 5,767,958 Y823F probably damaging Het
Zfp273 T A 13: 67,825,934 C394S probably damaging Het
Zfp286 G T 11: 62,780,991 A147D unknown Het
Zfp831 A G 2: 174,705,256 T1411A possibly damaging Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144836632 missense probably damaging 0.96
IGL00425:Clca3b APN 3 144836581 missense probably benign 0.14
IGL00725:Clca3b APN 3 144839162 missense probably benign 0.01
IGL00898:Clca3b APN 3 144844628 splice site probably benign
IGL00953:Clca3b APN 3 144847211 nonsense probably null
IGL01089:Clca3b APN 3 144823522 missense probably benign
IGL01376:Clca3b APN 3 144826051 missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144849163 missense probably benign 0.04
IGL02022:Clca3b APN 3 144841410 critical splice donor site probably null
IGL02200:Clca3b APN 3 144841429 missense probably damaging 1.00
IGL02314:Clca3b APN 3 144828142 splice site probably benign
IGL02331:Clca3b APN 3 144841406 splice site probably benign
IGL02429:Clca3b APN 3 144828135 missense probably damaging 1.00
IGL02868:Clca3b APN 3 144827564 missense probably damaging 1.00
IGL03095:Clca3b APN 3 144846910 nonsense probably null
IGL03331:Clca3b APN 3 144827963 missense probably benign
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0506:Clca3b UTSW 3 144822866 unclassified probably benign
R0524:Clca3b UTSW 3 144825321 missense probably benign
R0637:Clca3b UTSW 3 144827940 missense probably benign 0.03
R1577:Clca3b UTSW 3 144823519 missense probably damaging 1.00
R1641:Clca3b UTSW 3 144823513 missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144837824 missense probably damaging 1.00
R2240:Clca3b UTSW 3 144825935 missense probably benign 0.22
R2248:Clca3b UTSW 3 144825219 missense probably benign 0.01
R2259:Clca3b UTSW 3 144846381 missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144837853 missense probably benign 0.31
R2920:Clca3b UTSW 3 144846931 missense probably benign 0.01
R4355:Clca3b UTSW 3 144825458 splice site probably null
R4691:Clca3b UTSW 3 144839092 missense probably benign 0.02
R4828:Clca3b UTSW 3 144844512 missense probably benign 0.02
R4845:Clca3b UTSW 3 144825270 missense probably benign
R5182:Clca3b UTSW 3 144828015 missense probably damaging 0.99
R5396:Clca3b UTSW 3 144847171 missense probably damaging 0.99
R5429:Clca3b UTSW 3 144846459 missense probably damaging 1.00
R5572:Clca3b UTSW 3 144827309 missense probably damaging 1.00
R5657:Clca3b UTSW 3 144827383 missense probably benign 0.25
R5845:Clca3b UTSW 3 144825316 missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144825259 missense probably benign 0.18
R6677:Clca3b UTSW 3 144823384 missense probably benign 0.13
R6707:Clca3b UTSW 3 144844527 missense probably benign 0.00
R7001:Clca3b UTSW 3 144827972 missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144837758 missense probably benign 0.00
R7323:Clca3b UTSW 3 144825920 missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144841420 missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144836656 nonsense probably null
R7403:Clca3b UTSW 3 144823498 missense probably benign 0.00
R7798:Clca3b UTSW 3 144828130 missense probably damaging 1.00
R8008:Clca3b UTSW 3 144844609 missense probably benign 0.44
R8132:Clca3b UTSW 3 144847174 missense probably benign 0.13
R8181:Clca3b UTSW 3 144839137 missense probably benign 0.00
R8305:Clca3b UTSW 3 144825937 missense probably damaging 1.00
R8546:Clca3b UTSW 3 144827397 missense probably damaging 0.99
R8804:Clca3b UTSW 3 144839137 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGCTTAGCTCTATGCAAGGATTC -3'
(R):5'- TGACCAAGAAGAGTTGTCACTGAG -3'

Sequencing Primer
(F):5'- GCTCTATGCAAGGATTCCATTG -3'
(R):5'- TTGTCACTGAGGAAAAGATTTCAGG -3'
Posted On2021-04-30