Mutagenetix > Incidental Mutations

Incidental Mutation 'R8716:Exoc2'

669903

Institutional Source

Beutler Lab

Gene Symbol

Exoc2

Ensembl Gene

ENSMUSG00000021357

Gene Name

exocyst complex component 2

Synonyms

2410030I24Rik, Sec5l1, Sec5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R8716 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30813919-30974093 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30911244 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 223 (H223L)

Ref Sequence

ENSEMBL: ENSMUSP00000021785 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]

AlphaFold

Q9D4H1

PDB Structure

RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021785
AA Change: H223L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: H223L

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	3.2e-10	PFAM
Pfam:Sec5	198	377	3.6e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102946
AA Change: H223L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: H223L

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	2.5e-10	PFAM
Pfam:Sec5	198	377	7.5e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,293,774	Y1879C	probably benign	Het
Abce1	A	T	8: 79,701,155	I168N	possibly damaging	Het
Acan	G	A	7: 79,112,690	R2004H	probably damaging	Het
Acsm4	T	A	7: 119,708,660	L340Q	probably damaging	Het
Adamts2	T	A	11: 50,773,264	N342K	probably damaging	Het
Adgrd1	A	T	5: 129,188,371	D725V	possibly damaging	Het
Ahnak	T	A	19: 9,009,074	L2574Q	probably damaging	Het
Ank2	A	T	3: 126,942,839	L3132*	probably null	Het
Ap3b2	T	G	7: 81,477,153	E283A	probably benign	Het
Asb17	A	T	3: 153,853,514	L287F	probably damaging	Het
Atr	T	G	9: 95,907,415	N1541K	probably benign	Het
BC024978	C	A	7: 27,197,206	P65T	probably damaging	Het
Bcas3	G	A	11: 85,581,042	V711I	probably damaging	Het
Ccdc82	T	G	9: 13,253,297	Y262*	probably null	Het
Cd209d	CAT	C	8: 3,873,772		probably null	Het
Cdc23	GAGACTACCGAAGA	GAGA	18: 34,651,682		probably null	Het
Cfap54	T	A	10: 92,964,632	L1571F	probably benign	Het
Clca3b	C	T	3: 144,844,594	V197I	probably benign	Het
Cul9	T	C	17: 46,527,914	S932G	probably benign	Het
Cyp3a59	T	A	5: 146,096,601	D182E	probably damaging	Het
Ddx19a	T	C	8: 110,983,611	E119G	probably damaging	Het
Dnah1	A	G	14: 31,267,984		probably benign	Het
Dopey2	T	A	16: 93,780,785	L1761*	probably null	Het
Ehd2	A	G	7: 15,964,181	S44P	probably benign	Het
Fam217a	G	A	13: 34,924,265		probably benign	Het
Farp1	A	G	14: 121,242,443	N382S	probably benign	Het
Gbf1	T	A	19: 46,284,021	L1633Q	probably damaging	Het
Gpn1	C	T	5: 31,499,298	T115I	probably benign	Het
Gstcd	T	C	3: 132,983,189	D600G	probably damaging	Het
Ighv16-1	A	C	12: 114,068,996	M62R	probably benign	Het
Igsf3	T	G	3: 101,427,423	V272G	probably damaging	Het
Itgb2	T	C	10: 77,557,953	V409A	probably damaging	Het
Kcnh8	C	T	17: 52,977,752	P917S	probably benign	Het
Kif23	T	C	9: 61,937,195	T114A	probably damaging	Het
Krt35	A	G	11: 100,096,185	M1T	probably null	Het
Lgals4	C	T	7: 28,841,496	R282C	probably damaging	Het
Lonp2	T	C	8: 86,716,305	I798T	probably benign	Het
Lrp2	T	A	2: 69,443,794	T3971S	probably benign	Het
Mcc	C	A	18: 44,449,336	V758F	possibly damaging	Het
Naip2	C	T	13: 100,144,406	V1433I	probably benign	Het
Ndfip1	T	C	18: 38,452,331	F133L	probably damaging	Het
Nlrc4	T	A	17: 74,445,990	E466V	probably damaging	Het
Nwd1	A	G	8: 72,662,280	D112G	probably damaging	Het
Olfr1215	T	C	2: 89,001,716	T191A		Het
Olfr1495	T	C	19: 13,768,821	S160P	probably damaging	Het
Olfr859	C	T	9: 19,808,869	L184F	probably damaging	Het
Olfr94	C	T	17: 37,197,408	V112M	possibly damaging	Het
Opn4	G	T	14: 34,593,862	R405S	probably benign	Het
Oraov1	G	T	7: 144,915,193		probably benign	Het
Pde11a	T	A	2: 76,017,894	D863V	probably damaging	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Plekhf1	A	T	7: 38,221,898	L82Q	probably damaging	Het
Pou4f3	G	T	18: 42,395,528	D179Y	possibly damaging	Het
Ppp1r12a	G	A	10: 108,260,888	R713H	probably damaging	Het
Psg17	C	A	7: 18,821,385	G11W	probably benign	Het
Ptprh	A	T	7: 4,564,274	V533D	probably damaging	Het
Ptprn2	A	G	12: 117,255,548	D933G	possibly damaging	Het
Rab7	T	C	6: 88,012,387	S34G	probably damaging	Het
Rfx6	A	C	10: 51,681,872	H147P	probably damaging	Het
Rprd2	T	C	3: 95,776,793	Y310C	probably damaging	Het
Samd11	A	G	4: 156,249,270	F201S	probably benign	Het
Sox7	A	G	14: 63,948,588	T358A	probably benign	Het
Tenm4	C	T	7: 96,905,941	P2618S	probably benign	Het
Tie1	G	A	4: 118,482,738	T364M	possibly damaging	Het
Ttn	C	A	2: 76,766,922	L19882F	probably damaging	Het
Tyw1	G	A	5: 130,269,224	R202Q	probably damaging	Het
Ubr4	T	C	4: 139,468,853	W1267R	unknown	Het
Usp42	G	A	5: 143,717,941	P456S	probably damaging	Het
Vmn1r235	T	C	17: 21,262,292	V293A	possibly damaging	Het
Vmn2r90	T	A	17: 17,704,081	H47Q	probably damaging	Het
Vps13d	T	A	4: 145,075,778	T3503S		Het
Vwa5b2	T	A	16: 20,596,276	N349K	probably benign	Het
Zeb1	A	T	18: 5,767,958	Y823F	probably damaging	Het
Zfp273	T	A	13: 67,825,934	C394S	probably damaging	Het
Zfp286	G	T	11: 62,780,991	A147D	unknown	Het
Zfp831	A	G	2: 174,705,256	T1411A	possibly damaging	Het

Other mutations in Exoc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Exoc2	APN	13	30820626	missense	probably benign	0.17
IGL01839:Exoc2	APN	13	30906799	missense	probably damaging	1.00
IGL02092:Exoc2	APN	13	30875277	missense	probably benign	0.09
IGL02245:Exoc2	APN	13	30906859	missense	probably benign	0.10
IGL02267:Exoc2	APN	13	30815321	missense	probably benign
IGL02478:Exoc2	APN	13	30927420	missense	probably benign
IGL02500:Exoc2	APN	13	30911196	missense	probably damaging	1.00
IGL03081:Exoc2	APN	13	30900902	missense	probably benign	0.28
IGL03112:Exoc2	APN	13	30906587	splice site	probably benign
IGL03409:Exoc2	APN	13	30940737	utr 5 prime	probably benign
R0284:Exoc2	UTSW	13	30877625	splice site	probably benign
R0452:Exoc2	UTSW	13	30886327	splice site	probably benign
R0826:Exoc2	UTSW	13	30856797	critical splice acceptor site	probably null
R1251:Exoc2	UTSW	13	30886276	missense	probably benign	0.03
R1367:Exoc2	UTSW	13	30882273	nonsense	probably null
R1501:Exoc2	UTSW	13	30935502	missense	probably benign	0.01
R1593:Exoc2	UTSW	13	30856761	missense	possibly damaging	0.64
R1839:Exoc2	UTSW	13	30906497	splice site	probably benign
R1872:Exoc2	UTSW	13	30822661	missense	probably benign	0.17
R2064:Exoc2	UTSW	13	30935561	missense	probably benign	0.00
R2070:Exoc2	UTSW	13	30815370	missense	probably benign	0.00
R2227:Exoc2	UTSW	13	30864884	missense	probably benign
R2507:Exoc2	UTSW	13	30882365	missense	possibly damaging	0.55
R3965:Exoc2	UTSW	13	30877582	missense	probably benign	0.00
R4601:Exoc2	UTSW	13	30882268	missense	probably benign	0.05
R4914:Exoc2	UTSW	13	30876813	missense	probably benign	0.21
R5299:Exoc2	UTSW	13	30871918	splice site	probably null
R5410:Exoc2	UTSW	13	30864856	missense	probably damaging	0.98
R5461:Exoc2	UTSW	13	30925755	missense	possibly damaging	0.66
R5956:Exoc2	UTSW	13	30820623	missense	probably benign	0.03
R6056:Exoc2	UTSW	13	30900829	missense	probably benign	0.03
R6107:Exoc2	UTSW	13	30876797	missense	probably benign
R6548:Exoc2	UTSW	13	30826064	missense	possibly damaging	0.86
R6692:Exoc2	UTSW	13	30935507	missense	probably benign	0.09
R6969:Exoc2	UTSW	13	30911178	missense	probably benign
R7386:Exoc2	UTSW	13	30906663	splice site	probably null
R7461:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7467:Exoc2	UTSW	13	30925733	missense	probably damaging	0.98
R7473:Exoc2	UTSW	13	30822630	critical splice donor site	probably null
R7613:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7767:Exoc2	UTSW	13	30876769	missense	probably benign	0.01
R7793:Exoc2	UTSW	13	30911178	missense	probably benign	0.00
R7795:Exoc2	UTSW	13	30876773	nonsense	probably null
R7993:Exoc2	UTSW	13	30906730	critical splice donor site	probably null
R8085:Exoc2	UTSW	13	30940703	missense	probably damaging	1.00
R8330:Exoc2	UTSW	13	30877573	missense	probably benign
R8735:Exoc2	UTSW	13	30906839	missense	probably damaging	1.00
R8922:Exoc2	UTSW	13	30871855	missense	probably benign	0.05
R9237:Exoc2	UTSW	13	30864875	missense	probably benign
R9243:Exoc2	UTSW	13	30925795	missense	probably benign	0.03
R9365:Exoc2	UTSW	13	30856714	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGTCGTTACCAAGCCCTTGC -3'
(R):5'- AAGACCAGATGAGTGTGTCTGTTG -3'

Sequencing Primer
(F):5'- CCTTGCCCTGGGAAATCC -3'
(R):5'- ACCAGATGAGTGTGTCTGTTGTATAC -3'

Posted On

2021-04-30