Incidental Mutation 'R8716:Exoc2'
ID 669903
Institutional Source Beutler Lab
Gene Symbol Exoc2
Ensembl Gene ENSMUSG00000021357
Gene Name exocyst complex component 2
Synonyms 2410030I24Rik, Sec5l1, Sec5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock # R8716 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 30813919-30974093 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30911244 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 223 (H223L)
Ref Sequence ENSEMBL: ENSMUSP00000021785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]
AlphaFold Q9D4H1
PDB Structure RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000021785
AA Change: H223L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: H223L

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102946
AA Change: H223L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: H223L

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,774 Y1879C probably benign Het
Abce1 A T 8: 79,701,155 I168N possibly damaging Het
Acan G A 7: 79,112,690 R2004H probably damaging Het
Acsm4 T A 7: 119,708,660 L340Q probably damaging Het
Adamts2 T A 11: 50,773,264 N342K probably damaging Het
Adgrd1 A T 5: 129,188,371 D725V possibly damaging Het
Ahnak T A 19: 9,009,074 L2574Q probably damaging Het
Ank2 A T 3: 126,942,839 L3132* probably null Het
Ap3b2 T G 7: 81,477,153 E283A probably benign Het
Asb17 A T 3: 153,853,514 L287F probably damaging Het
Atr T G 9: 95,907,415 N1541K probably benign Het
BC024978 C A 7: 27,197,206 P65T probably damaging Het
Bcas3 G A 11: 85,581,042 V711I probably damaging Het
Ccdc82 T G 9: 13,253,297 Y262* probably null Het
Cd209d CAT C 8: 3,873,772 probably null Het
Cdc23 GAGACTACCGAAGA GAGA 18: 34,651,682 probably null Het
Cfap54 T A 10: 92,964,632 L1571F probably benign Het
Clca3b C T 3: 144,844,594 V197I probably benign Het
Cul9 T C 17: 46,527,914 S932G probably benign Het
Cyp3a59 T A 5: 146,096,601 D182E probably damaging Het
Ddx19a T C 8: 110,983,611 E119G probably damaging Het
Dnah1 A G 14: 31,267,984 probably benign Het
Dopey2 T A 16: 93,780,785 L1761* probably null Het
Ehd2 A G 7: 15,964,181 S44P probably benign Het
Fam217a G A 13: 34,924,265 probably benign Het
Farp1 A G 14: 121,242,443 N382S probably benign Het
Gbf1 T A 19: 46,284,021 L1633Q probably damaging Het
Gpn1 C T 5: 31,499,298 T115I probably benign Het
Gstcd T C 3: 132,983,189 D600G probably damaging Het
Ighv16-1 A C 12: 114,068,996 M62R probably benign Het
Igsf3 T G 3: 101,427,423 V272G probably damaging Het
Itgb2 T C 10: 77,557,953 V409A probably damaging Het
Kcnh8 C T 17: 52,977,752 P917S probably benign Het
Kif23 T C 9: 61,937,195 T114A probably damaging Het
Krt35 A G 11: 100,096,185 M1T probably null Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lonp2 T C 8: 86,716,305 I798T probably benign Het
Lrp2 T A 2: 69,443,794 T3971S probably benign Het
Mcc C A 18: 44,449,336 V758F possibly damaging Het
Naip2 C T 13: 100,144,406 V1433I probably benign Het
Ndfip1 T C 18: 38,452,331 F133L probably damaging Het
Nlrc4 T A 17: 74,445,990 E466V probably damaging Het
Nwd1 A G 8: 72,662,280 D112G probably damaging Het
Olfr1215 T C 2: 89,001,716 T191A Het
Olfr1495 T C 19: 13,768,821 S160P probably damaging Het
Olfr859 C T 9: 19,808,869 L184F probably damaging Het
Olfr94 C T 17: 37,197,408 V112M possibly damaging Het
Opn4 G T 14: 34,593,862 R405S probably benign Het
Oraov1 G T 7: 144,915,193 probably benign Het
Pde11a T A 2: 76,017,894 D863V probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekhf1 A T 7: 38,221,898 L82Q probably damaging Het
Pou4f3 G T 18: 42,395,528 D179Y possibly damaging Het
Ppp1r12a G A 10: 108,260,888 R713H probably damaging Het
Psg17 C A 7: 18,821,385 G11W probably benign Het
Ptprh A T 7: 4,564,274 V533D probably damaging Het
Ptprn2 A G 12: 117,255,548 D933G possibly damaging Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rfx6 A C 10: 51,681,872 H147P probably damaging Het
Rprd2 T C 3: 95,776,793 Y310C probably damaging Het
Samd11 A G 4: 156,249,270 F201S probably benign Het
Sox7 A G 14: 63,948,588 T358A probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tie1 G A 4: 118,482,738 T364M possibly damaging Het
Ttn C A 2: 76,766,922 L19882F probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ubr4 T C 4: 139,468,853 W1267R unknown Het
Usp42 G A 5: 143,717,941 P456S probably damaging Het
Vmn1r235 T C 17: 21,262,292 V293A possibly damaging Het
Vmn2r90 T A 17: 17,704,081 H47Q probably damaging Het
Vps13d T A 4: 145,075,778 T3503S Het
Vwa5b2 T A 16: 20,596,276 N349K probably benign Het
Zeb1 A T 18: 5,767,958 Y823F probably damaging Het
Zfp273 T A 13: 67,825,934 C394S probably damaging Het
Zfp286 G T 11: 62,780,991 A147D unknown Het
Zfp831 A G 2: 174,705,256 T1411A possibly damaging Het
Other mutations in Exoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Exoc2 APN 13 30820626 missense probably benign 0.17
IGL01839:Exoc2 APN 13 30906799 missense probably damaging 1.00
IGL02092:Exoc2 APN 13 30875277 missense probably benign 0.09
IGL02245:Exoc2 APN 13 30906859 missense probably benign 0.10
IGL02267:Exoc2 APN 13 30815321 missense probably benign
IGL02478:Exoc2 APN 13 30927420 missense probably benign
IGL02500:Exoc2 APN 13 30911196 missense probably damaging 1.00
IGL03081:Exoc2 APN 13 30900902 missense probably benign 0.28
IGL03112:Exoc2 APN 13 30906587 splice site probably benign
IGL03409:Exoc2 APN 13 30940737 utr 5 prime probably benign
R0284:Exoc2 UTSW 13 30877625 splice site probably benign
R0452:Exoc2 UTSW 13 30886327 splice site probably benign
R0826:Exoc2 UTSW 13 30856797 critical splice acceptor site probably null
R1251:Exoc2 UTSW 13 30886276 missense probably benign 0.03
R1367:Exoc2 UTSW 13 30882273 nonsense probably null
R1501:Exoc2 UTSW 13 30935502 missense probably benign 0.01
R1593:Exoc2 UTSW 13 30856761 missense possibly damaging 0.64
R1839:Exoc2 UTSW 13 30906497 splice site probably benign
R1872:Exoc2 UTSW 13 30822661 missense probably benign 0.17
R2064:Exoc2 UTSW 13 30935561 missense probably benign 0.00
R2070:Exoc2 UTSW 13 30815370 missense probably benign 0.00
R2227:Exoc2 UTSW 13 30864884 missense probably benign
R2507:Exoc2 UTSW 13 30882365 missense possibly damaging 0.55
R3965:Exoc2 UTSW 13 30877582 missense probably benign 0.00
R4601:Exoc2 UTSW 13 30882268 missense probably benign 0.05
R4914:Exoc2 UTSW 13 30876813 missense probably benign 0.21
R5299:Exoc2 UTSW 13 30871918 splice site probably null
R5410:Exoc2 UTSW 13 30864856 missense probably damaging 0.98
R5461:Exoc2 UTSW 13 30925755 missense possibly damaging 0.66
R5956:Exoc2 UTSW 13 30820623 missense probably benign 0.03
R6056:Exoc2 UTSW 13 30900829 missense probably benign 0.03
R6107:Exoc2 UTSW 13 30876797 missense probably benign
R6548:Exoc2 UTSW 13 30826064 missense possibly damaging 0.86
R6692:Exoc2 UTSW 13 30935507 missense probably benign 0.09
R6969:Exoc2 UTSW 13 30911178 missense probably benign
R7386:Exoc2 UTSW 13 30906663 splice site probably null
R7461:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7467:Exoc2 UTSW 13 30925733 missense probably damaging 0.98
R7473:Exoc2 UTSW 13 30822630 critical splice donor site probably null
R7613:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7767:Exoc2 UTSW 13 30876769 missense probably benign 0.01
R7793:Exoc2 UTSW 13 30911178 missense probably benign 0.00
R7795:Exoc2 UTSW 13 30876773 nonsense probably null
R7993:Exoc2 UTSW 13 30906730 critical splice donor site probably null
R8085:Exoc2 UTSW 13 30940703 missense probably damaging 1.00
R8330:Exoc2 UTSW 13 30877573 missense probably benign
R8735:Exoc2 UTSW 13 30906839 missense probably damaging 1.00
R8922:Exoc2 UTSW 13 30871855 missense probably benign 0.05
R9237:Exoc2 UTSW 13 30864875 missense probably benign
R9243:Exoc2 UTSW 13 30925795 missense probably benign 0.03
R9365:Exoc2 UTSW 13 30856714 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCGTTACCAAGCCCTTGC -3'
(R):5'- AAGACCAGATGAGTGTGTCTGTTG -3'

Sequencing Primer
(F):5'- CCTTGCCCTGGGAAATCC -3'
(R):5'- ACCAGATGAGTGTGTCTGTTGTATAC -3'
Posted On 2021-04-30