Incidental Mutation 'R8716:Farp1'
ID669910
Institutional Source Beutler Lab
Gene Symbol Farp1
Ensembl Gene ENSMUSG00000025555
Gene NameFERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived)
SynonymsCdep
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8716 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location121035200-121283744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121242443 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 382 (N382S)
Ref Sequence ENSEMBL: ENSMUSP00000026635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026635]
Predicted Effect probably benign
Transcript: ENSMUST00000026635
AA Change: N382S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026635
Gene: ENSMUSG00000025555
AA Change: N382S

DomainStartEndE-ValueType
B41 36 230 3.27e-68 SMART
FERM_C 234 324 3.87e-32 SMART
FA 328 374 6.07e-16 SMART
RhoGEF 546 732 2.07e-47 SMART
PH 763 861 1.05e-16 SMART
PH 936 1034 1.55e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a FERM (4.2, exrin, radixin, moesin) domain, a Dbl homology domain, and two pleckstrin homology domains. These domains are found in guanine nucleotide exchange factors and proteins that link the cytoskeleton to the cell membrane. The encoded protein functions in neurons to promote dendritic growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,774 Y1879C probably benign Het
Abce1 A T 8: 79,701,155 I168N possibly damaging Het
Acan G A 7: 79,112,690 R2004H probably damaging Het
Acsm4 T A 7: 119,708,660 L340Q probably damaging Het
Adamts2 T A 11: 50,773,264 N342K probably damaging Het
Adgrd1 A T 5: 129,188,371 D725V possibly damaging Het
Ahnak T A 19: 9,009,074 L2574Q probably damaging Het
Ank2 A T 3: 126,942,839 L3132* probably null Het
Ap3b2 T G 7: 81,477,153 E283A probably benign Het
Asb17 A T 3: 153,853,514 L287F probably damaging Het
Atr T G 9: 95,907,415 N1541K probably benign Het
BC024978 C A 7: 27,197,206 P65T probably damaging Het
Bcas3 G A 11: 85,581,042 V711I probably damaging Het
Ccdc82 T G 9: 13,253,297 Y262* probably null Het
Cd209d CAT C 8: 3,873,772 probably null Het
Cdc23 GAGACTACCGAAGA GAGA 18: 34,651,682 probably null Het
Cfap54 T A 10: 92,964,632 L1571F probably benign Het
Clca3b C T 3: 144,844,594 V197I probably benign Het
Cul9 T C 17: 46,527,914 S932G probably benign Het
Cyp3a59 T A 5: 146,096,601 D182E probably damaging Het
Ddx19a T C 8: 110,983,611 E119G probably damaging Het
Dnah1 A G 14: 31,267,984 probably benign Het
Dopey2 T A 16: 93,780,785 L1761* probably null Het
Ehd2 A G 7: 15,964,181 S44P probably benign Het
Exoc2 T A 13: 30,911,244 H223L probably damaging Het
Fam217a G A 13: 34,924,265 probably benign Het
Gbf1 T A 19: 46,284,021 L1633Q probably damaging Het
Gpn1 C T 5: 31,499,298 T115I probably benign Het
Gstcd T C 3: 132,983,189 D600G probably damaging Het
Ighv16-1 A C 12: 114,068,996 M62R probably benign Het
Igsf3 T G 3: 101,427,423 V272G probably damaging Het
Itgb2 T C 10: 77,557,953 V409A probably damaging Het
Kcnh8 C T 17: 52,977,752 P917S probably benign Het
Kif23 T C 9: 61,937,195 T114A probably damaging Het
Krt35 A G 11: 100,096,185 M1T probably null Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lonp2 T C 8: 86,716,305 I798T probably benign Het
Lrp2 T A 2: 69,443,794 T3971S probably benign Het
Mcc C A 18: 44,449,336 V758F possibly damaging Het
Naip2 C T 13: 100,144,406 V1433I probably benign Het
Ndfip1 T C 18: 38,452,331 F133L probably damaging Het
Nlrc4 T A 17: 74,445,990 E466V probably damaging Het
Nwd1 A G 8: 72,662,280 D112G probably damaging Het
Olfr1215 T C 2: 89,001,716 T191A Het
Olfr1495 T C 19: 13,768,821 S160P probably damaging Het
Olfr859 C T 9: 19,808,869 L184F probably damaging Het
Olfr94 C T 17: 37,197,408 V112M possibly damaging Het
Opn4 G T 14: 34,593,862 R405S probably benign Het
Oraov1 G T 7: 144,915,193 probably benign Het
Pde11a T A 2: 76,017,894 D863V probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekhf1 A T 7: 38,221,898 L82Q probably damaging Het
Pou4f3 G T 18: 42,395,528 D179Y possibly damaging Het
Ppp1r12a G A 10: 108,260,888 R713H probably damaging Het
Psg17 C A 7: 18,821,385 G11W probably benign Het
Ptprh A T 7: 4,564,274 V533D probably damaging Het
Ptprn2 A G 12: 117,255,548 D933G possibly damaging Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rfx6 A C 10: 51,681,872 H147P probably damaging Het
Rprd2 T C 3: 95,776,793 Y310C probably damaging Het
Samd11 A G 4: 156,249,270 F201S probably benign Het
Sox7 A G 14: 63,948,588 T358A probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tie1 G A 4: 118,482,738 T364M possibly damaging Het
Ttn C A 2: 76,766,922 L19882F probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ubr4 T C 4: 139,468,853 W1267R unknown Het
Usp42 G A 5: 143,717,941 P456S probably damaging Het
Vmn1r235 T C 17: 21,262,292 V293A possibly damaging Het
Vmn2r90 T A 17: 17,704,081 H47Q probably damaging Het
Vps13d T A 4: 145,075,778 T3503S Het
Vwa5b2 T A 16: 20,596,276 N349K probably benign Het
Zeb1 A T 18: 5,767,958 Y823F probably damaging Het
Zfp273 T A 13: 67,825,934 C394S probably damaging Het
Zfp286 G T 11: 62,780,991 A147D unknown Het
Zfp831 A G 2: 174,705,256 T1411A possibly damaging Het
Other mutations in Farp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Farp1 APN 14 121237149 missense probably damaging 1.00
IGL01017:Farp1 APN 14 121272774 missense possibly damaging 0.64
IGL02309:Farp1 APN 14 121243516 missense probably benign
IGL02376:Farp1 APN 14 121272856 missense probably damaging 0.98
IGL03018:Farp1 APN 14 121102169 missense probably benign
IGL03400:Farp1 APN 14 121207321 missense probably damaging 1.00
R0034:Farp1 UTSW 14 121255429 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0219:Farp1 UTSW 14 121243600 missense possibly damaging 0.88
R0359:Farp1 UTSW 14 121255396 splice site probably benign
R0616:Farp1 UTSW 14 121277022 missense probably damaging 1.00
R0653:Farp1 UTSW 14 121233846 critical splice donor site probably null
R0710:Farp1 UTSW 14 121237143 missense probably damaging 1.00
R1391:Farp1 UTSW 14 121257966 nonsense probably null
R1791:Farp1 UTSW 14 121256745 missense probably damaging 1.00
R1920:Farp1 UTSW 14 121255496 missense probably benign 0.16
R1953:Farp1 UTSW 14 121255482 missense probably benign
R1958:Farp1 UTSW 14 121219375 critical splice acceptor site probably null
R2891:Farp1 UTSW 14 121256736 missense probably damaging 1.00
R3121:Farp1 UTSW 14 121222726 splice site probably benign
R4005:Farp1 UTSW 14 121276397 missense probably damaging 0.99
R4257:Farp1 UTSW 14 121255479 missense probably benign 0.00
R4559:Farp1 UTSW 14 121272801 missense probably damaging 1.00
R4654:Farp1 UTSW 14 121276304 missense possibly damaging 0.50
R4739:Farp1 UTSW 14 121238787 missense probably damaging 1.00
R4831:Farp1 UTSW 14 121277057 missense probably damaging 1.00
R4988:Farp1 UTSW 14 121275607 missense probably damaging 1.00
R5379:Farp1 UTSW 14 121256757 missense possibly damaging 0.88
R5463:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5466:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5467:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5511:Farp1 UTSW 14 121237172 missense probably damaging 0.98
R5520:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5635:Farp1 UTSW 14 121276304 missense possibly damaging 0.96
R5639:Farp1 UTSW 14 121275382 missense probably damaging 1.00
R5954:Farp1 UTSW 14 121222667 missense probably damaging 0.99
R6765:Farp1 UTSW 14 121222654 missense probably benign 0.00
R7469:Farp1 UTSW 14 121275421 missense probably damaging 1.00
R7549:Farp1 UTSW 14 121235177 missense possibly damaging 0.89
R7660:Farp1 UTSW 14 121276922 missense probably benign 0.00
R7752:Farp1 UTSW 14 121257947 missense probably damaging 1.00
R7788:Farp1 UTSW 14 121276253 missense probably benign 0.12
R7911:Farp1 UTSW 14 121242406 missense probably damaging 1.00
R8013:Farp1 UTSW 14 121242401 missense probably damaging 1.00
R8078:Farp1 UTSW 14 121276300 missense probably benign 0.04
R8113:Farp1 UTSW 14 121275596 missense probably benign 0.35
R8116:Farp1 UTSW 14 121233820 missense probably damaging 1.00
RF024:Farp1 UTSW 14 121237148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAGCAGCTAGAACAGGATTC -3'
(R):5'- CAGACTCATGAGGTGCAGAG -3'

Sequencing Primer
(F):5'- CCACACCGGCATTTAGAAAATATTG -3'
(R):5'- GTGCAGAGCCCAAAGCCAG -3'
Posted On2021-04-30