Incidental Mutation 'R8716:Gbf1'
ID669926
Institutional Source Beutler Lab
Gene Symbol Gbf1
Ensembl Gene ENSMUSG00000025224
Gene Namegolgi-specific brefeldin A-resistance factor 1
Synonyms1700083E03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8716 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location46152509-46286510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46284021 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1633 (L1633Q)
Ref Sequence ENSEMBL: ENSMUSP00000026254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000175747] [ENSMUST00000176992]
AlphaFold Q6DFZ1
Predicted Effect probably damaging
Transcript: ENSMUST00000026254
AA Change: L1633Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: L1633Q

DomainStartEndE-ValueType
low complexity region 270 288 N/A INTRINSIC
Pfam:Sec7_N 400 551 3.4e-29 PFAM
Sec7 696 884 8.55e-91 SMART
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1773 1793 N/A INTRINSIC
low complexity region 1802 1820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175747
Predicted Effect probably damaging
Transcript: ENSMUST00000176992
AA Change: L1575Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: L1575Q

DomainStartEndE-ValueType
low complexity region 216 234 N/A INTRINSIC
Pfam:Sec7_N 343 498 1.5e-35 PFAM
Sec7 642 830 8.55e-91 SMART
low complexity region 1144 1162 N/A INTRINSIC
low complexity region 1227 1242 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1744 1762 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,774 Y1879C probably benign Het
Abce1 A T 8: 79,701,155 I168N possibly damaging Het
Acan G A 7: 79,112,690 R2004H probably damaging Het
Acsm4 T A 7: 119,708,660 L340Q probably damaging Het
Adamts2 T A 11: 50,773,264 N342K probably damaging Het
Adgrd1 A T 5: 129,188,371 D725V possibly damaging Het
Ahnak T A 19: 9,009,074 L2574Q probably damaging Het
Ank2 A T 3: 126,942,839 L3132* probably null Het
Ap3b2 T G 7: 81,477,153 E283A probably benign Het
Asb17 A T 3: 153,853,514 L287F probably damaging Het
Atr T G 9: 95,907,415 N1541K probably benign Het
BC024978 C A 7: 27,197,206 P65T probably damaging Het
Bcas3 G A 11: 85,581,042 V711I probably damaging Het
Ccdc82 T G 9: 13,253,297 Y262* probably null Het
Cd209d CAT C 8: 3,873,772 probably null Het
Cdc23 GAGACTACCGAAGA GAGA 18: 34,651,682 probably null Het
Cfap54 T A 10: 92,964,632 L1571F probably benign Het
Clca3b C T 3: 144,844,594 V197I probably benign Het
Cul9 T C 17: 46,527,914 S932G probably benign Het
Cyp3a59 T A 5: 146,096,601 D182E probably damaging Het
Ddx19a T C 8: 110,983,611 E119G probably damaging Het
Dnah1 A G 14: 31,267,984 probably benign Het
Dopey2 T A 16: 93,780,785 L1761* probably null Het
Ehd2 A G 7: 15,964,181 S44P probably benign Het
Exoc2 T A 13: 30,911,244 H223L probably damaging Het
Fam217a G A 13: 34,924,265 probably benign Het
Farp1 A G 14: 121,242,443 N382S probably benign Het
Gpn1 C T 5: 31,499,298 T115I probably benign Het
Gstcd T C 3: 132,983,189 D600G probably damaging Het
Ighv16-1 A C 12: 114,068,996 M62R probably benign Het
Igsf3 T G 3: 101,427,423 V272G probably damaging Het
Itgb2 T C 10: 77,557,953 V409A probably damaging Het
Kcnh8 C T 17: 52,977,752 P917S probably benign Het
Kif23 T C 9: 61,937,195 T114A probably damaging Het
Krt35 A G 11: 100,096,185 M1T probably null Het
Lgals4 C T 7: 28,841,496 R282C probably damaging Het
Lonp2 T C 8: 86,716,305 I798T probably benign Het
Lrp2 T A 2: 69,443,794 T3971S probably benign Het
Mcc C A 18: 44,449,336 V758F possibly damaging Het
Naip2 C T 13: 100,144,406 V1433I probably benign Het
Ndfip1 T C 18: 38,452,331 F133L probably damaging Het
Nlrc4 T A 17: 74,445,990 E466V probably damaging Het
Nwd1 A G 8: 72,662,280 D112G probably damaging Het
Olfr1215 T C 2: 89,001,716 T191A Het
Olfr1495 T C 19: 13,768,821 S160P probably damaging Het
Olfr859 C T 9: 19,808,869 L184F probably damaging Het
Olfr94 C T 17: 37,197,408 V112M possibly damaging Het
Opn4 G T 14: 34,593,862 R405S probably benign Het
Oraov1 G T 7: 144,915,193 probably benign Het
Pde11a T A 2: 76,017,894 D863V probably damaging Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekhf1 A T 7: 38,221,898 L82Q probably damaging Het
Pou4f3 G T 18: 42,395,528 D179Y possibly damaging Het
Ppp1r12a G A 10: 108,260,888 R713H probably damaging Het
Psg17 C A 7: 18,821,385 G11W probably benign Het
Ptprh A T 7: 4,564,274 V533D probably damaging Het
Ptprn2 A G 12: 117,255,548 D933G possibly damaging Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rfx6 A C 10: 51,681,872 H147P probably damaging Het
Rprd2 T C 3: 95,776,793 Y310C probably damaging Het
Samd11 A G 4: 156,249,270 F201S probably benign Het
Sox7 A G 14: 63,948,588 T358A probably benign Het
Tenm4 C T 7: 96,905,941 P2618S probably benign Het
Tie1 G A 4: 118,482,738 T364M possibly damaging Het
Ttn C A 2: 76,766,922 L19882F probably damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ubr4 T C 4: 139,468,853 W1267R unknown Het
Usp42 G A 5: 143,717,941 P456S probably damaging Het
Vmn1r235 T C 17: 21,262,292 V293A possibly damaging Het
Vmn2r90 T A 17: 17,704,081 H47Q probably damaging Het
Vps13d T A 4: 145,075,778 T3503S Het
Vwa5b2 T A 16: 20,596,276 N349K probably benign Het
Zeb1 A T 18: 5,767,958 Y823F probably damaging Het
Zfp273 T A 13: 67,825,934 C394S probably damaging Het
Zfp286 G T 11: 62,780,991 A147D unknown Het
Zfp831 A G 2: 174,705,256 T1411A possibly damaging Het
Other mutations in Gbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gbf1 APN 19 46284249 critical splice acceptor site probably null
IGL00988:Gbf1 APN 19 46284120 critical splice donor site probably null
IGL01352:Gbf1 APN 19 46265215 missense probably damaging 1.00
IGL01432:Gbf1 APN 19 46279995 missense probably damaging 1.00
IGL01469:Gbf1 APN 19 46279364 missense probably damaging 1.00
IGL01870:Gbf1 APN 19 46285669 missense probably benign 0.00
IGL02019:Gbf1 APN 19 46279292 missense possibly damaging 0.93
IGL02061:Gbf1 APN 19 46279258 missense possibly damaging 0.65
IGL02126:Gbf1 APN 19 46252117 missense probably damaging 0.97
IGL02272:Gbf1 APN 19 46269803 missense probably damaging 1.00
IGL02346:Gbf1 APN 19 46285930 missense probably damaging 1.00
IGL02491:Gbf1 APN 19 46262540 unclassified probably benign
IGL03003:Gbf1 APN 19 46255655 missense probably damaging 1.00
IGL03130:Gbf1 APN 19 46267348 missense possibly damaging 0.82
IGL03376:Gbf1 APN 19 46262521 missense possibly damaging 0.94
PIT4651001:Gbf1 UTSW 19 46163543 missense probably benign
R0107:Gbf1 UTSW 19 46284828 missense probably benign
R0139:Gbf1 UTSW 19 46261792 missense probably damaging 1.00
R0180:Gbf1 UTSW 19 46285722 missense probably benign
R0255:Gbf1 UTSW 19 46254110 splice site probably benign
R0317:Gbf1 UTSW 19 46254020 missense probably benign
R0329:Gbf1 UTSW 19 46272270 critical splice donor site probably null
R0372:Gbf1 UTSW 19 46285704 missense probably benign
R0666:Gbf1 UTSW 19 46262544 unclassified probably benign
R1463:Gbf1 UTSW 19 46271545 unclassified probably benign
R1701:Gbf1 UTSW 19 46261675 missense probably damaging 1.00
R1848:Gbf1 UTSW 19 46272037 missense possibly damaging 0.90
R1962:Gbf1 UTSW 19 46267219 missense probably damaging 1.00
R1965:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R1966:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R2177:Gbf1 UTSW 19 46265670 missense probably benign
R2238:Gbf1 UTSW 19 46163618 missense probably benign
R2239:Gbf1 UTSW 19 46163618 missense probably benign
R2520:Gbf1 UTSW 19 46265367 missense probably benign
R3821:Gbf1 UTSW 19 46264807 missense probably damaging 0.99
R4681:Gbf1 UTSW 19 46280550 missense probably benign 0.41
R4695:Gbf1 UTSW 19 46259167 nonsense probably null
R4785:Gbf1 UTSW 19 46268395 missense possibly damaging 0.89
R5202:Gbf1 UTSW 19 46268454 missense probably benign 0.13
R5359:Gbf1 UTSW 19 46283725 critical splice donor site probably null
R5468:Gbf1 UTSW 19 46284296 missense possibly damaging 0.92
R5593:Gbf1 UTSW 19 46272524 missense possibly damaging 0.91
R5595:Gbf1 UTSW 19 46284422 missense possibly damaging 0.74
R5796:Gbf1 UTSW 19 46284343 missense probably benign 0.08
R5938:Gbf1 UTSW 19 46268452 missense probably damaging 1.00
R5957:Gbf1 UTSW 19 46246221 critical splice donor site probably null
R6059:Gbf1 UTSW 19 46265248 missense probably damaging 1.00
R6120:Gbf1 UTSW 19 46279321 missense possibly damaging 0.83
R6239:Gbf1 UTSW 19 46259696 missense probably benign 0.00
R6252:Gbf1 UTSW 19 46271556 missense probably benign 0.33
R6310:Gbf1 UTSW 19 46280005 missense probably damaging 0.96
R6787:Gbf1 UTSW 19 46271772 missense probably benign
R6805:Gbf1 UTSW 19 46262507 missense probably damaging 1.00
R6855:Gbf1 UTSW 19 46279941 missense probably benign 0.00
R7313:Gbf1 UTSW 19 46280354 missense possibly damaging 0.94
R7414:Gbf1 UTSW 19 46283358 nonsense probably null
R7646:Gbf1 UTSW 19 46283672 missense probably damaging 1.00
R7650:Gbf1 UTSW 19 46272539 missense probably damaging 1.00
R7789:Gbf1 UTSW 19 46254002 missense probably damaging 1.00
R7801:Gbf1 UTSW 19 46272643 missense probably benign 0.03
R8241:Gbf1 UTSW 19 46246137 missense probably damaging 1.00
R8851:Gbf1 UTSW 19 46268483 missense probably damaging 1.00
Z1177:Gbf1 UTSW 19 46259142 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTGCTCATTTCATGAACCCC -3'
(R):5'- CAAGCAGTAATGGAACCACG -3'

Sequencing Primer
(F):5'- TTCATGAACCCCTAGCTATGGAG -3'
(R):5'- GCTAAGACAGAGGCTGCCAC -3'
Posted On2021-04-30