Incidental Mutation 'R8717:Tnn'
ID 669928
Institutional Source Beutler Lab
Gene Symbol Tnn
Ensembl Gene ENSMUSG00000026725
Gene Name tenascin N
Synonyms Tnw, tenascin-W
MMRRC Submission
Accession Numbers

Genbank: NM_177839.3; Ensembl: ENSMUST00000039178

Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock # R8717 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 160085029-160153580 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 160116276 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 989 (V989A)
Ref Sequence ENSEMBL: ENSMUSP00000039452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039178] [ENSMUST00000131919]
AlphaFold Q80Z71
Predicted Effect possibly damaging
Transcript: ENSMUST00000039178
AA Change: V989A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039452
Gene: ENSMUSG00000026725
AA Change: V989A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.34e-9 SMART
FN3 883 960 9.04e-9 SMART
FN3 971 1048 1.07e-10 SMART
FN3 1059 1136 7.57e-11 SMART
FN3 1147 1224 4.59e-10 SMART
FN3 1235 1312 1.95e-4 SMART
FBG 1327 1539 1.16e-114 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131919
SMART Domains Protein: ENSMUSP00000115685
Gene: ENSMUSG00000026725

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 100 132 N/A INTRINSIC
EGF_like 170 198 3.5e1 SMART
EGF 201 229 2.29e1 SMART
EGF_like 232 260 2.86e1 SMART
FN3 262 341 1.81e-8 SMART
FN3 351 432 1.08e-6 SMART
FN3 443 521 1.19e-8 SMART
FN3 531 608 2.64e-10 SMART
FN3 619 696 1.6e-9 SMART
FN3 707 784 9.04e-9 SMART
FN3 795 872 7.57e-11 SMART
FN3 883 960 4.59e-10 SMART
FN3 971 1048 1.95e-4 SMART
FBG 1063 1275 1.16e-114 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik A G 9: 58,499,340 T178A probably damaging Het
A2ml1 A G 6: 128,566,995 F528L probably benign Het
Aadacl3 T G 4: 144,456,208 D230A probably damaging Het
Adgrf3 T A 5: 30,198,581 probably benign Het
Agtr1a A C 13: 30,381,374 T141P probably damaging Het
Ankfy1 T A 11: 72,730,474 D195E probably benign Het
AY074887 G A 9: 54,950,502 T113I probably damaging Het
Cacna1c G A 6: 119,057,353 A71V Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cntrl T A 2: 35,113,339 V78E probably benign Het
Cyp2c67 T A 19: 39,638,711 Y225F probably benign Het
Cyp2j13 T A 4: 96,045,540 H369L probably benign Het
Dagla T C 19: 10,248,223 E859G probably benign Het
Duox1 C A 2: 122,337,671 S1092R possibly damaging Het
Elfn2 C A 15: 78,672,361 S662I probably benign Het
Epor A T 9: 21,959,445 C380S probably benign Het
Fam213a G A 14: 40,998,879 P126S possibly damaging Het
Fsd2 T C 7: 81,540,342 E564G probably benign Het
Hace1 C T 10: 45,605,598 T117I unknown Het
Ift172 A G 5: 31,255,641 M1488T probably benign Het
Kdm3b A G 18: 34,819,787 E1070G probably damaging Het
Lrp6 A G 6: 134,457,748 F1331L probably benign Het
Lrrc74a G A 12: 86,736,479 E33K probably damaging Het
Magel2 T C 7: 62,377,672 M108T unknown Het
Mief1 T C 15: 80,248,383 S127P probably benign Het
Mprip T C 11: 59,759,700 V1410A probably benign Het
Muc1 G A 3: 89,231,514 V477M possibly damaging Het
Nat8f3 A T 6: 85,761,705 M25K possibly damaging Het
Neb T G 2: 52,183,769 H5942P probably damaging Het
Nf2 A T 11: 4,816,099 Y144N probably damaging Het
Nipbl T A 15: 8,338,741 M1166L probably benign Het
Npnt A T 3: 132,908,375 L206Q probably damaging Het
Olfr1288 A G 2: 111,479,647 T288A probably damaging Het
Olfr1337 T C 4: 118,781,799 Y262C probably damaging Het
Olfr808 T A 10: 129,768,258 I254N probably damaging Het
Parg A G 14: 32,210,535 K444R probably benign Het
Pcbp4 A T 9: 106,460,003 probably null Het
Pcdhgb4 A G 18: 37,720,794 S81G probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekho2 T C 9: 65,556,776 N264D probably benign Het
Pmpca T A 2: 26,391,881 M182K probably damaging Het
Prdm10 A G 9: 31,341,399 H476R probably benign Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rbp3 G A 14: 33,956,438 R781H probably damaging Het
Rngtt T A 4: 33,368,695 S409R probably damaging Het
Ryr1 C A 7: 29,052,328 R3680L probably benign Het
Sbno1 T C 5: 124,374,555 S1384G possibly damaging Het
Shmt1 T C 11: 60,794,937 D271G probably benign Het
Sin3a C T 9: 57,127,226 R1228W probably damaging Het
Slc25a39 T C 11: 102,403,794 R294G probably benign Het
Smcr8 T A 11: 60,779,428 S467R probably damaging Het
Spaca7 A G 8: 12,586,480 Y102C probably damaging Het
Tacr1 A G 6: 82,403,725 Y39C probably damaging Het
Tenm3 G A 8: 48,299,645 S894L possibly damaging Het
Tmem115 T A 9: 107,537,933 M307K possibly damaging Het
Trabd2b T A 4: 114,602,989 N441K probably damaging Het
Ttll1 T C 15: 83,489,508 K368R probably benign Het
Tubgcp2 C T 7: 139,996,792 V858I probably benign Het
Ufsp2 G T 8: 45,983,577 V122L probably benign Het
Wdr26 A G 1: 181,184,348 C470R possibly damaging Het
Xab2 T C 8: 3,613,845 H358R probably benign Het
Xrcc5 A G 1: 72,383,746 I697V probably benign Het
Other mutations in Tnn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Tnn APN 1 160125451 missense possibly damaging 0.65
IGL00433:Tnn APN 1 160098206 splice site probably benign
IGL00858:Tnn APN 1 160088392 critical splice donor site probably null
IGL00939:Tnn APN 1 160147530 missense probably damaging 1.00
IGL01569:Tnn APN 1 160120554 missense possibly damaging 0.51
IGL01591:Tnn APN 1 160125574 missense probably damaging 1.00
IGL01628:Tnn APN 1 160147602 missense possibly damaging 0.89
IGL01811:Tnn APN 1 160107135 missense probably damaging 1.00
IGL01813:Tnn APN 1 160088438 missense probably damaging 1.00
IGL02340:Tnn APN 1 160145205 missense probably benign 0.00
IGL02488:Tnn APN 1 160140593 missense probably benign 0.21
IGL02535:Tnn APN 1 160122652 splice site probably null
IGL02563:Tnn APN 1 160114553 missense probably damaging 1.00
IGL02572:Tnn APN 1 160086107 missense probably damaging 1.00
IGL02740:Tnn APN 1 160140777 splice site probably benign
IGL02818:Tnn APN 1 160116278 missense possibly damaging 0.86
IGL03284:Tnn APN 1 160125452 missense probably benign 0.01
1mM(1):Tnn UTSW 1 160097341 missense probably damaging 1.00
PIT4305001:Tnn UTSW 1 160086077 missense possibly damaging 0.91
R0023:Tnn UTSW 1 160104928 missense probably benign 0.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0234:Tnn UTSW 1 160088466 missense probably damaging 1.00
R0316:Tnn UTSW 1 160120567 missense possibly damaging 0.93
R0492:Tnn UTSW 1 160120757 missense probably damaging 0.99
R0547:Tnn UTSW 1 160116337 intron probably benign
R1067:Tnn UTSW 1 160125398 missense probably damaging 1.00
R1563:Tnn UTSW 1 160125415 missense probably damaging 1.00
R1565:Tnn UTSW 1 160097265 missense probably damaging 1.00
R1615:Tnn UTSW 1 160118408 missense possibly damaging 0.93
R1637:Tnn UTSW 1 160147600 missense probably damaging 1.00
R1707:Tnn UTSW 1 160145144 missense probably damaging 1.00
R1758:Tnn UTSW 1 160147584 missense possibly damaging 0.61
R1797:Tnn UTSW 1 160140688 missense probably damaging 1.00
R1847:Tnn UTSW 1 160116182 missense possibly damaging 0.51
R1925:Tnn UTSW 1 160097229 missense probably damaging 1.00
R2182:Tnn UTSW 1 160140600 splice site probably null
R2196:Tnn UTSW 1 160097228 nonsense probably null
R2225:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2227:Tnn UTSW 1 160147465 missense probably damaging 1.00
R2286:Tnn UTSW 1 160110509 missense possibly damaging 0.89
R2850:Tnn UTSW 1 160139287 missense probably benign 0.00
R3110:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3111:Tnn UTSW 1 160107055 missense probably damaging 0.98
R3112:Tnn UTSW 1 160116286 missense possibly damaging 0.71
R3729:Tnn UTSW 1 160146240 missense probably damaging 1.00
R4183:Tnn UTSW 1 160097355 missense probably damaging 1.00
R4439:Tnn UTSW 1 160116080 missense probably benign
R4441:Tnn UTSW 1 160116080 missense probably benign
R4588:Tnn UTSW 1 160145111 missense probably benign 0.25
R4646:Tnn UTSW 1 160146042 missense probably benign
R4647:Tnn UTSW 1 160146042 missense probably benign
R4648:Tnn UTSW 1 160146042 missense probably benign
R4701:Tnn UTSW 1 160147768 missense possibly damaging 0.72
R4703:Tnn UTSW 1 160116245 missense possibly damaging 0.84
R4737:Tnn UTSW 1 160146089 missense probably damaging 1.00
R4801:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4802:Tnn UTSW 1 160145033 missense possibly damaging 0.90
R4868:Tnn UTSW 1 160130873 missense possibly damaging 0.64
R4977:Tnn UTSW 1 160120618 missense probably damaging 1.00
R5011:Tnn UTSW 1 160126379 missense possibly damaging 0.89
R5026:Tnn UTSW 1 160146137 missense probably benign 0.00
R5027:Tnn UTSW 1 160145211 missense probably damaging 1.00
R5049:Tnn UTSW 1 160140738 missense probably benign 0.00
R5119:Tnn UTSW 1 160120552 missense probably damaging 0.98
R5128:Tnn UTSW 1 160122894 missense probably damaging 0.98
R5234:Tnn UTSW 1 160144999 missense possibly damaging 0.95
R5398:Tnn UTSW 1 160147522 missense probably benign 0.00
R5424:Tnn UTSW 1 160122702 missense possibly damaging 0.69
R5452:Tnn UTSW 1 160110261 missense probably benign 0.13
R5466:Tnn UTSW 1 160120536 missense possibly damaging 0.93
R6022:Tnn UTSW 1 160110358 missense probably benign 0.00
R6062:Tnn UTSW 1 160098278 missense probably damaging 1.00
R6086:Tnn UTSW 1 160086120 missense probably damaging 1.00
R6132:Tnn UTSW 1 160146071 missense probably damaging 0.96
R6324:Tnn UTSW 1 160145204 missense probably damaging 0.96
R6455:Tnn UTSW 1 160114719 missense probably damaging 1.00
R6563:Tnn UTSW 1 160088398 missense probably damaging 1.00
R6650:Tnn UTSW 1 160114583 missense probably damaging 1.00
R6806:Tnn UTSW 1 160120708 missense possibly damaging 0.95
R6810:Tnn UTSW 1 160104842 missense probably damaging 1.00
R7157:Tnn UTSW 1 160126377 nonsense probably null
R7243:Tnn UTSW 1 160107117 missense probably benign 0.07
R7340:Tnn UTSW 1 160146022 missense probably damaging 0.98
R7472:Tnn UTSW 1 160110347 missense probably benign 0.12
R7502:Tnn UTSW 1 160110359 missense probably benign 0.00
R7527:Tnn UTSW 1 160118504 missense possibly damaging 0.51
R7608:Tnn UTSW 1 160088414 nonsense probably null
R7746:Tnn UTSW 1 160114685 missense probably damaging 0.97
R8096:Tnn UTSW 1 160122841 missense probably damaging 1.00
R8136:Tnn UTSW 1 160107060 missense probably damaging 0.96
R8191:Tnn UTSW 1 160125518 missense probably damaging 1.00
R8334:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8335:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8337:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8338:Tnn UTSW 1 160118483 missense probably damaging 1.00
R8427:Tnn UTSW 1 160130686 missense probably damaging 0.99
R8433:Tnn UTSW 1 160097220 missense possibly damaging 0.81
R8479:Tnn UTSW 1 160122827 missense probably benign 0.06
R8505:Tnn UTSW 1 160146023 missense probably damaging 0.98
R8554:Tnn UTSW 1 160110416 missense probably damaging 1.00
R8850:Tnn UTSW 1 160110244 critical splice donor site probably null
R8928:Tnn UTSW 1 160125529 missense probably damaging 1.00
R9209:Tnn UTSW 1 160126416 missense probably benign 0.02
X0019:Tnn UTSW 1 160086146 missense probably damaging 1.00
Z1176:Tnn UTSW 1 160146293 missense probably benign
Z1177:Tnn UTSW 1 160126527 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TACCTGTGTGACCTTCGGTG -3'
(R):5'- GTGGAACCAAGAGTCTCTGTC -3'

Sequencing Primer
(F):5'- ACCTTCGGTGTTGGCTTTC -3'
(R):5'- CCAAGAGTCTCTGTCTATGAGATCAC -3'
Posted On 2021-04-30