Incidental Mutation 'R8717:A2ml1'
ID669948
Institutional Source Beutler Lab
Gene Symbol A2ml1
Ensembl Gene ENSMUSG00000047228
Gene Namealpha-2-macroglobulin like 1
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8717 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location128539821-128581608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128566995 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 528 (F528L)
Ref Sequence ENSEMBL: ENSMUSP00000059426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060574]
Predicted Effect probably benign
Transcript: ENSMUST00000060574
AA Change: F528L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: F528L

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
Pfam:A2M_N 120 213 6.3e-17 PFAM
A2M_N_2 448 594 2.95e-37 SMART
A2M 736 826 2.11e-33 SMART
Pfam:Thiol-ester_cl 959 988 3.1e-17 PFAM
Pfam:A2M_comp 1008 1255 2.3e-71 PFAM
A2M_recep 1361 1447 1.22e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik A G 9: 58,499,340 T178A probably damaging Het
Aadacl3 T G 4: 144,456,208 D230A probably damaging Het
Adgrf3 T A 5: 30,198,581 probably benign Het
Agtr1a A C 13: 30,381,374 T141P probably damaging Het
Ankfy1 T A 11: 72,730,474 D195E probably benign Het
AY074887 G A 9: 54,950,502 T113I probably damaging Het
Cacna1c G A 6: 119,057,353 A71V Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cntrl T A 2: 35,113,339 V78E probably benign Het
Cyp2c67 T A 19: 39,638,711 Y225F probably benign Het
Cyp2j13 T A 4: 96,045,540 H369L probably benign Het
Dagla T C 19: 10,248,223 E859G probably benign Het
Duox1 C A 2: 122,337,671 S1092R possibly damaging Het
Elfn2 C A 15: 78,672,361 S662I probably benign Het
Epor A T 9: 21,959,445 C380S probably benign Het
Fam213a G A 14: 40,998,879 P126S possibly damaging Het
Fsd2 T C 7: 81,540,342 E564G probably benign Het
Hace1 C T 10: 45,605,598 T117I unknown Het
Ift172 A G 5: 31,255,641 M1488T probably benign Het
Kdm3b A G 18: 34,819,787 E1070G probably damaging Het
Lrp6 A G 6: 134,457,748 F1331L probably benign Het
Lrrc74a G A 12: 86,736,479 E33K probably damaging Het
Magel2 T C 7: 62,377,672 M108T unknown Het
Mief1 T C 15: 80,248,383 S127P probably benign Het
Mprip T C 11: 59,759,700 V1410A probably benign Het
Muc1 G A 3: 89,231,514 V477M possibly damaging Het
Nat8f3 A T 6: 85,761,705 M25K possibly damaging Het
Neb T G 2: 52,183,769 H5942P probably damaging Het
Nf2 A T 11: 4,816,099 Y144N probably damaging Het
Nipbl T A 15: 8,338,741 M1166L probably benign Het
Npnt A T 3: 132,908,375 L206Q probably damaging Het
Olfr1288 A G 2: 111,479,647 T288A probably damaging Het
Olfr1337 T C 4: 118,781,799 Y262C probably damaging Het
Olfr808 T A 10: 129,768,258 I254N probably damaging Het
Parg A G 14: 32,210,535 K444R probably benign Het
Pcbp4 A T 9: 106,460,003 probably null Het
Pcdhgb4 A G 18: 37,720,794 S81G probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekho2 T C 9: 65,556,776 N264D probably benign Het
Pmpca T A 2: 26,391,881 M182K probably damaging Het
Prdm10 A G 9: 31,341,399 H476R probably benign Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rbp3 G A 14: 33,956,438 R781H probably damaging Het
Rngtt T A 4: 33,368,695 S409R probably damaging Het
Ryr1 C A 7: 29,052,328 R3680L probably benign Het
Sbno1 T C 5: 124,374,555 S1384G possibly damaging Het
Shmt1 T C 11: 60,794,937 D271G probably benign Het
Sin3a C T 9: 57,127,226 R1228W probably damaging Het
Slc25a39 T C 11: 102,403,794 R294G probably benign Het
Smcr8 T A 11: 60,779,428 S467R probably damaging Het
Spaca7 A G 8: 12,586,480 Y102C probably damaging Het
Tacr1 A G 6: 82,403,725 Y39C probably damaging Het
Tenm3 G A 8: 48,299,645 S894L possibly damaging Het
Tmem115 T A 9: 107,537,933 M307K possibly damaging Het
Tnn A G 1: 160,116,276 V989A possibly damaging Het
Trabd2b T A 4: 114,602,989 N441K probably damaging Het
Ttll1 T C 15: 83,489,508 K368R probably benign Het
Tubgcp2 C T 7: 139,996,792 V858I probably benign Het
Ufsp2 G T 8: 45,983,577 V122L probably benign Het
Wdr26 A G 1: 181,184,348 C470R possibly damaging Het
Xab2 T C 8: 3,613,845 H358R probably benign Het
Xrcc5 A G 1: 72,383,746 I697V probably benign Het
Other mutations in A2ml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:A2ml1 APN 6 128578156 missense possibly damaging 0.78
IGL00596:A2ml1 APN 6 128570067 missense probably damaging 0.99
IGL00912:A2ml1 APN 6 128552307 missense probably benign 0.04
IGL01320:A2ml1 APN 6 128575588 missense probably benign 0.00
IGL01470:A2ml1 APN 6 128580412 missense probably damaging 0.96
IGL01576:A2ml1 APN 6 128554330 splice site probably benign
IGL01761:A2ml1 APN 6 128546337 missense possibly damaging 0.61
IGL01792:A2ml1 APN 6 128560679 missense probably benign 0.04
IGL01843:A2ml1 APN 6 128553338 splice site probably benign
IGL01946:A2ml1 APN 6 128570479 missense possibly damaging 0.81
IGL02016:A2ml1 APN 6 128558335 missense probably damaging 1.00
IGL02170:A2ml1 APN 6 128547210 missense possibly damaging 0.58
IGL02269:A2ml1 APN 6 128553338 splice site probably benign
IGL02589:A2ml1 APN 6 128581500 missense probably benign 0.00
IGL02959:A2ml1 APN 6 128567060 missense probably benign 0.04
IGL02970:A2ml1 APN 6 128569979 missense probably damaging 1.00
IGL03206:A2ml1 APN 6 128553276 missense possibly damaging 0.50
IGL03298:A2ml1 APN 6 128543960 missense probably benign 0.00
1mM(1):A2ml1 UTSW 6 128580960 missense probably benign 0.02
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0128:A2ml1 UTSW 6 128575639 splice site probably benign
R0299:A2ml1 UTSW 6 128553232 splice site probably benign
R0523:A2ml1 UTSW 6 128558326 missense possibly damaging 0.92
R0565:A2ml1 UTSW 6 128568743 nonsense probably null
R0599:A2ml1 UTSW 6 128552245 missense probably damaging 1.00
R0626:A2ml1 UTSW 6 128550773 missense probably damaging 0.99
R0732:A2ml1 UTSW 6 128546448 missense probably damaging 1.00
R0880:A2ml1 UTSW 6 128560646 missense possibly damaging 0.49
R1070:A2ml1 UTSW 6 128543300 missense probably damaging 1.00
R1166:A2ml1 UTSW 6 128570917 missense probably benign 0.00
R1278:A2ml1 UTSW 6 128558507 missense probably damaging 1.00
R1421:A2ml1 UTSW 6 128543960 missense probably benign 0.00
R1536:A2ml1 UTSW 6 128547233 nonsense probably null
R1786:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R1808:A2ml1 UTSW 6 128543299 missense probably damaging 1.00
R1813:A2ml1 UTSW 6 128566273 missense probably benign 0.34
R1863:A2ml1 UTSW 6 128550783 missense probably damaging 0.99
R2007:A2ml1 UTSW 6 128542892 missense probably benign 0.13
R2062:A2ml1 UTSW 6 128552308 missense probably benign 0.08
R2127:A2ml1 UTSW 6 128558437 missense probably damaging 1.00
R2130:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2131:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2201:A2ml1 UTSW 6 128547305 missense probably null 0.34
R2319:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2321:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2322:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2369:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2370:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2371:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2372:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2375:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2893:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2894:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3438:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3615:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3616:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3773:A2ml1 UTSW 6 128555083 missense probably benign 0.02
R3785:A2ml1 UTSW 6 128544924 critical splice donor site probably null
R3803:A2ml1 UTSW 6 128545070 missense probably benign 0.17
R3824:A2ml1 UTSW 6 128568763 missense probably damaging 0.99
R3878:A2ml1 UTSW 6 128554361 missense probably benign 0.05
R4176:A2ml1 UTSW 6 128545037 missense possibly damaging 0.68
R4229:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4230:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4348:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4351:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4352:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4353:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4427:A2ml1 UTSW 6 128545046 missense probably benign 0.00
R4971:A2ml1 UTSW 6 128547227 missense probably damaging 0.98
R5014:A2ml1 UTSW 6 128543933 missense probably benign 0.00
R5369:A2ml1 UTSW 6 128568833 missense probably damaging 0.97
R5532:A2ml1 UTSW 6 128553330 critical splice acceptor site probably null
R5860:A2ml1 UTSW 6 128541061 missense probably benign 0.15
R5872:A2ml1 UTSW 6 128561526 missense probably damaging 1.00
R5926:A2ml1 UTSW 6 128560645 missense probably benign
R5977:A2ml1 UTSW 6 128581122 missense probably damaging 1.00
R5980:A2ml1 UTSW 6 128567055 missense possibly damaging 0.82
R6014:A2ml1 UTSW 6 128571985 missense probably damaging 1.00
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6061:A2ml1 UTSW 6 128568712 missense probably damaging 1.00
R6327:A2ml1 UTSW 6 128558692 splice site probably null
R6331:A2ml1 UTSW 6 128552236 missense probably damaging 0.96
R6465:A2ml1 UTSW 6 128541078 missense probably damaging 1.00
R6640:A2ml1 UTSW 6 128553285 missense probably benign 0.41
R6792:A2ml1 UTSW 6 128546329 nonsense probably null
R6793:A2ml1 UTSW 6 128546329 nonsense probably null
R7207:A2ml1 UTSW 6 128550771 missense probably benign 0.04
R7378:A2ml1 UTSW 6 128546247 critical splice donor site probably null
R7556:A2ml1 UTSW 6 128569964 missense probably damaging 1.00
R8010:A2ml1 UTSW 6 128580340 missense probably benign 0.08
R8017:A2ml1 UTSW 6 128581447 critical splice donor site probably null
R8019:A2ml1 UTSW 6 128581447 critical splice donor site probably null
R8035:A2ml1 UTSW 6 128553280 missense probably damaging 0.99
R8094:A2ml1 UTSW 6 128572082 missense probably damaging 1.00
R8144:A2ml1 UTSW 6 128569999 missense possibly damaging 0.84
R8365:A2ml1 UTSW 6 128580955 nonsense probably null
R8382:A2ml1 UTSW 6 128560682 missense probably benign 0.01
R8388:A2ml1 UTSW 6 128571974 missense probably benign 0.03
R8947:A2ml1 UTSW 6 128552256 missense probably damaging 1.00
R8970:A2ml1 UTSW 6 128568763 missense probably damaging 0.99
R9025:A2ml1 UTSW 6 128557582 missense possibly damaging 0.49
RF014:A2ml1 UTSW 6 128570068 missense probably damaging 0.96
X0063:A2ml1 UTSW 6 128572012 missense probably benign
Z1176:A2ml1 UTSW 6 128571977 missense probably benign 0.09
Z1177:A2ml1 UTSW 6 128545076 missense probably benign
Z1177:A2ml1 UTSW 6 128561616 nonsense probably null
Z1177:A2ml1 UTSW 6 128575607 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CTATGTAAGGATCATGAGGGGC -3'
(R):5'- CAAGGCCCAGGTCATTTCTC -3'

Sequencing Primer
(F):5'- TGACAGCTTGAGGTCTATCCAGC -3'
(R):5'- AAGGCCCAGGTCATTTCTCTATCC -3'
Posted On2021-04-30