Incidental Mutation 'R8717:Ankfy1'
ID 669973
Institutional Source Beutler Lab
Gene Symbol Ankfy1
Ensembl Gene ENSMUSG00000020790
Gene Name ankyrin repeat and FYVE domain containing 1
Synonyms Ankhzn
MMRRC Submission
Accession Numbers

Genbank: NM_009671.5

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8717 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 72690006-72772146 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 72730474 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 195 (D195E)
Ref Sequence ENSEMBL: ENSMUSP00000118751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127610] [ENSMUST00000155998]
AlphaFold Q810B6
Predicted Effect possibly damaging
Transcript: ENSMUST00000127610
AA Change: D195E

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118252
Gene: ENSMUSG00000020790
AA Change: D195E

DomainStartEndE-ValueType
Blast:UBCc 4 33 3e-8 BLAST
BTB 68 162 3.26e-20 SMART
Blast:ANK 217 247 6e-8 BLAST
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 395 4.73e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155998
AA Change: D195E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000118751
Gene: ENSMUSG00000020790
AA Change: D195E

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
BTB 68 162 3.26e-20 SMART
ANK 255 284 5.29e0 SMART
ANK 288 317 1.04e2 SMART
ANK 322 362 4.3e0 SMART
ANK 366 396 9.75e1 SMART
ANK 400 452 8.5e2 SMART
low complexity region 465 478 N/A INTRINSIC
ANK 490 519 4.56e-4 SMART
ANK 542 572 3.18e-3 SMART
ANK 588 617 1.72e1 SMART
ANK 621 650 5.16e-3 SMART
ANK 654 683 8.14e-1 SMART
ANK 687 716 5.37e-1 SMART
ANK 724 753 3.08e-1 SMART
ANK 769 798 2.56e-7 SMART
ANK 802 830 1.93e-2 SMART
ANK 836 865 3.47e2 SMART
ANK 870 899 9.49e-2 SMART
ANK 905 934 2.41e-3 SMART
ANK 938 967 1.34e-1 SMART
ANK 971 1001 4.43e-2 SMART
Blast:ANK 1005 1039 2e-16 BLAST
ANK 1043 1074 5.67e0 SMART
FYVE 1099 1165 3.98e-28 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains a coiled-coil structure and a BTB/POZ domain at its N-terminus, ankyrin repeats in the middle portion, and a FYVE-finger motif at its C-terminus. This protein belongs to a subgroup of double zinc finger proteins which may be involved in vesicle or protein transport. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality with no apparent neural developmental defects on a mixed genetic background but show complete embryonic lethality on highly homogenous genetic backgrounds. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik A G 9: 58,499,340 T178A probably damaging Het
A2ml1 A G 6: 128,566,995 F528L probably benign Het
Aadacl3 T G 4: 144,456,208 D230A probably damaging Het
Adgrf3 T A 5: 30,198,581 probably benign Het
Agtr1a A C 13: 30,381,374 T141P probably damaging Het
AY074887 G A 9: 54,950,502 T113I probably damaging Het
Cacna1c G A 6: 119,057,353 A71V Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cntrl T A 2: 35,113,339 V78E probably benign Het
Cyp2c67 T A 19: 39,638,711 Y225F probably benign Het
Cyp2j13 T A 4: 96,045,540 H369L probably benign Het
Dagla T C 19: 10,248,223 E859G probably benign Het
Duox1 C A 2: 122,337,671 S1092R possibly damaging Het
Elfn2 C A 15: 78,672,361 S662I probably benign Het
Epor A T 9: 21,959,445 C380S probably benign Het
Fam213a G A 14: 40,998,879 P126S possibly damaging Het
Fsd2 T C 7: 81,540,342 E564G probably benign Het
Hace1 C T 10: 45,605,598 T117I unknown Het
Ift172 A G 5: 31,255,641 M1488T probably benign Het
Kdm3b A G 18: 34,819,787 E1070G probably damaging Het
Lrp6 A G 6: 134,457,748 F1331L probably benign Het
Lrrc74a G A 12: 86,736,479 E33K probably damaging Het
Magel2 T C 7: 62,377,672 M108T unknown Het
Mief1 T C 15: 80,248,383 S127P probably benign Het
Mprip T C 11: 59,759,700 V1410A probably benign Het
Muc1 G A 3: 89,231,514 V477M possibly damaging Het
Nat8f3 A T 6: 85,761,705 M25K possibly damaging Het
Neb T G 2: 52,183,769 H5942P probably damaging Het
Nf2 A T 11: 4,816,099 Y144N probably damaging Het
Nipbl T A 15: 8,338,741 M1166L probably benign Het
Npnt A T 3: 132,908,375 L206Q probably damaging Het
Olfr1288 A G 2: 111,479,647 T288A probably damaging Het
Olfr1337 T C 4: 118,781,799 Y262C probably damaging Het
Olfr808 T A 10: 129,768,258 I254N probably damaging Het
Parg A G 14: 32,210,535 K444R probably benign Het
Pcbp4 A T 9: 106,460,003 probably null Het
Pcdhgb4 A G 18: 37,720,794 S81G probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekho2 T C 9: 65,556,776 N264D probably benign Het
Pmpca T A 2: 26,391,881 M182K probably damaging Het
Prdm10 A G 9: 31,341,399 H476R probably benign Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rbp3 G A 14: 33,956,438 R781H probably damaging Het
Rngtt T A 4: 33,368,695 S409R probably damaging Het
Ryr1 C A 7: 29,052,328 R3680L probably benign Het
Sbno1 T C 5: 124,374,555 S1384G possibly damaging Het
Shmt1 T C 11: 60,794,937 D271G probably benign Het
Sin3a C T 9: 57,127,226 R1228W probably damaging Het
Slc25a39 T C 11: 102,403,794 R294G probably benign Het
Smcr8 T A 11: 60,779,428 S467R probably damaging Het
Spaca7 A G 8: 12,586,480 Y102C probably damaging Het
Tacr1 A G 6: 82,403,725 Y39C probably damaging Het
Tenm3 G A 8: 48,299,645 S894L possibly damaging Het
Tmem115 T A 9: 107,537,933 M307K possibly damaging Het
Tnn A G 1: 160,116,276 V989A possibly damaging Het
Trabd2b T A 4: 114,602,989 N441K probably damaging Het
Ttll1 T C 15: 83,489,508 K368R probably benign Het
Tubgcp2 C T 7: 139,996,792 V858I probably benign Het
Ufsp2 G T 8: 45,983,577 V122L probably benign Het
Wdr26 A G 1: 181,184,348 C470R possibly damaging Het
Xab2 T C 8: 3,613,845 H358R probably benign Het
Xrcc5 A G 1: 72,383,746 I697V probably benign Het
Other mutations in Ankfy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Ankfy1 APN 11 72728772 missense probably benign 0.03
IGL00837:Ankfy1 APN 11 72755898 splice site probably benign
IGL01061:Ankfy1 APN 11 72728860 nonsense probably null
IGL01305:Ankfy1 APN 11 72764791 missense probably damaging 1.00
IGL01599:Ankfy1 APN 11 72738365 missense probably benign
IGL01918:Ankfy1 APN 11 72740455 missense probably benign 0.09
IGL03007:Ankfy1 APN 11 72750521 missense probably damaging 0.98
IGL03134:Ankfy1 APN 11 72712185 missense probably damaging 1.00
IGL03182:Ankfy1 APN 11 72728754 splice site probably benign
Betruenken UTSW 11 72753608 missense possibly damaging 0.78
Inebriated UTSW 11 72752105 missense probably benign
Smashed UTSW 11 72712204 missense probably damaging 1.00
woozy UTSW 11 72754459 missense probably benign 0.33
ANU22:Ankfy1 UTSW 11 72764791 missense probably damaging 1.00
I2289:Ankfy1 UTSW 11 72730485 missense probably benign 0.01
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0062:Ankfy1 UTSW 11 72712204 missense probably damaging 1.00
R0569:Ankfy1 UTSW 11 72753608 missense possibly damaging 0.78
R0787:Ankfy1 UTSW 11 72760296 missense probably damaging 1.00
R1303:Ankfy1 UTSW 11 72750071 splice site probably null
R1522:Ankfy1 UTSW 11 72755867 nonsense probably null
R1552:Ankfy1 UTSW 11 72754495 critical splice donor site probably null
R1565:Ankfy1 UTSW 11 72757318 missense probably damaging 1.00
R1899:Ankfy1 UTSW 11 72754407 nonsense probably null
R1900:Ankfy1 UTSW 11 72754407 nonsense probably null
R1950:Ankfy1 UTSW 11 72760329 missense probably damaging 1.00
R2421:Ankfy1 UTSW 11 72755896 splice site probably benign
R3429:Ankfy1 UTSW 11 72712154 splice site probably benign
R3801:Ankfy1 UTSW 11 72749420 missense probably benign
R4079:Ankfy1 UTSW 11 72690009 utr 5 prime probably benign
R4119:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4120:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4165:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4233:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4234:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4236:Ankfy1 UTSW 11 72714484 critical splice donor site probably null
R4735:Ankfy1 UTSW 11 72730611 missense probably benign
R4765:Ankfy1 UTSW 11 72712291 missense probably benign 0.05
R4904:Ankfy1 UTSW 11 72752105 missense probably benign
R5057:Ankfy1 UTSW 11 72759919 missense probably damaging 1.00
R5454:Ankfy1 UTSW 11 72746931 missense probably benign 0.00
R5471:Ankfy1 UTSW 11 72728791 missense probably benign 0.01
R5737:Ankfy1 UTSW 11 72732274 missense probably damaging 0.98
R5770:Ankfy1 UTSW 11 72760256 missense probably damaging 1.00
R5896:Ankfy1 UTSW 11 72759985 missense probably damaging 0.98
R5930:Ankfy1 UTSW 11 72712245 missense probably benign 0.00
R5960:Ankfy1 UTSW 11 72757352 missense possibly damaging 0.91
R6169:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6176:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6177:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6178:Ankfy1 UTSW 11 72754459 missense probably benign 0.33
R6477:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6513:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6521:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6523:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R6524:Ankfy1 UTSW 11 72730482 missense possibly damaging 0.76
R7006:Ankfy1 UTSW 11 72740464 missense probably benign 0.01
R7329:Ankfy1 UTSW 11 72712208 missense probably damaging 0.96
R7393:Ankfy1 UTSW 11 72738308 missense possibly damaging 0.70
R7410:Ankfy1 UTSW 11 72761504 missense probably damaging 1.00
R7488:Ankfy1 UTSW 11 72759943 missense probably benign 0.05
R7731:Ankfy1 UTSW 11 72712281 missense probably benign 0.00
R7810:Ankfy1 UTSW 11 72754455 nonsense probably null
R8236:Ankfy1 UTSW 11 72754355 missense possibly damaging 0.90
R8709:Ankfy1 UTSW 11 72755706 missense possibly damaging 0.91
R8839:Ankfy1 UTSW 11 72730566 missense probably benign 0.39
R8862:Ankfy1 UTSW 11 72753643 missense probably benign 0.18
R8954:Ankfy1 UTSW 11 72750491 missense possibly damaging 0.91
R9548:Ankfy1 UTSW 11 72750179 critical splice donor site probably null
R9762:Ankfy1 UTSW 11 72730575 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCAGACTTGTGTGAGCTCTC -3'
(R):5'- TGTCTACTGATGGTGCAGAGAG -3'

Sequencing Primer
(F):5'- ACTTGTGTGAGCTCTCTGGCC -3'
(R):5'- TGTTGATAACATTAAAGTTTGGGGAG -3'
Posted On 2021-04-30