Incidental Mutation 'R8717:Cyp2c67'
ID 669987
Institutional Source Beutler Lab
Gene Symbol Cyp2c67
Ensembl Gene ENSMUSG00000062624
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 67
Synonyms C730004C24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R8717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 39608842-39649051 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 39638711 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 225 (Y225F)
Ref Sequence ENSEMBL: ENSMUSP00000065796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067328]
AlphaFold Q569X9
Predicted Effect probably benign
Transcript: ENSMUST00000067328
AA Change: Y225F

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: Y225F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 8.5e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik A G 9: 58,499,340 T178A probably damaging Het
A2ml1 A G 6: 128,566,995 F528L probably benign Het
Aadacl3 T G 4: 144,456,208 D230A probably damaging Het
Adgrf3 T A 5: 30,198,581 probably benign Het
Agtr1a A C 13: 30,381,374 T141P probably damaging Het
Ankfy1 T A 11: 72,730,474 D195E probably benign Het
AY074887 G A 9: 54,950,502 T113I probably damaging Het
Cacna1c G A 6: 119,057,353 A71V Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cntrl T A 2: 35,113,339 V78E probably benign Het
Cyp2j13 T A 4: 96,045,540 H369L probably benign Het
Dagla T C 19: 10,248,223 E859G probably benign Het
Duox1 C A 2: 122,337,671 S1092R possibly damaging Het
Elfn2 C A 15: 78,672,361 S662I probably benign Het
Epor A T 9: 21,959,445 C380S probably benign Het
Fam213a G A 14: 40,998,879 P126S possibly damaging Het
Fsd2 T C 7: 81,540,342 E564G probably benign Het
Hace1 C T 10: 45,605,598 T117I unknown Het
Ift172 A G 5: 31,255,641 M1488T probably benign Het
Kdm3b A G 18: 34,819,787 E1070G probably damaging Het
Lrp6 A G 6: 134,457,748 F1331L probably benign Het
Lrrc74a G A 12: 86,736,479 E33K probably damaging Het
Magel2 T C 7: 62,377,672 M108T unknown Het
Mief1 T C 15: 80,248,383 S127P probably benign Het
Mprip T C 11: 59,759,700 V1410A probably benign Het
Muc1 G A 3: 89,231,514 V477M possibly damaging Het
Nat8f3 A T 6: 85,761,705 M25K possibly damaging Het
Neb T G 2: 52,183,769 H5942P probably damaging Het
Nf2 A T 11: 4,816,099 Y144N probably damaging Het
Nipbl T A 15: 8,338,741 M1166L probably benign Het
Npnt A T 3: 132,908,375 L206Q probably damaging Het
Olfr1288 A G 2: 111,479,647 T288A probably damaging Het
Olfr1337 T C 4: 118,781,799 Y262C probably damaging Het
Olfr808 T A 10: 129,768,258 I254N probably damaging Het
Parg A G 14: 32,210,535 K444R probably benign Het
Pcbp4 A T 9: 106,460,003 probably null Het
Pcdhgb4 A G 18: 37,720,794 S81G probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekho2 T C 9: 65,556,776 N264D probably benign Het
Pmpca T A 2: 26,391,881 M182K probably damaging Het
Prdm10 A G 9: 31,341,399 H476R probably benign Het
Rab7 T C 6: 88,012,387 S34G probably damaging Het
Rbp3 G A 14: 33,956,438 R781H probably damaging Het
Rngtt T A 4: 33,368,695 S409R probably damaging Het
Ryr1 C A 7: 29,052,328 R3680L probably benign Het
Sbno1 T C 5: 124,374,555 S1384G possibly damaging Het
Shmt1 T C 11: 60,794,937 D271G probably benign Het
Sin3a C T 9: 57,127,226 R1228W probably damaging Het
Slc25a39 T C 11: 102,403,794 R294G probably benign Het
Smcr8 T A 11: 60,779,428 S467R probably damaging Het
Spaca7 A G 8: 12,586,480 Y102C probably damaging Het
Tacr1 A G 6: 82,403,725 Y39C probably damaging Het
Tenm3 G A 8: 48,299,645 S894L possibly damaging Het
Tmem115 T A 9: 107,537,933 M307K possibly damaging Het
Tnn A G 1: 160,116,276 V989A possibly damaging Het
Trabd2b T A 4: 114,602,989 N441K probably damaging Het
Ttll1 T C 15: 83,489,508 K368R probably benign Het
Tubgcp2 C T 7: 139,996,792 V858I probably benign Het
Ufsp2 G T 8: 45,983,577 V122L probably benign Het
Wdr26 A G 1: 181,184,348 C470R possibly damaging Het
Xab2 T C 8: 3,613,845 H358R probably benign Het
Xrcc5 A G 1: 72,383,746 I697V probably benign Het
Other mutations in Cyp2c67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Cyp2c67 APN 19 39643385 missense possibly damaging 0.95
IGL01025:Cyp2c67 APN 19 39639932 nonsense probably null
IGL01363:Cyp2c67 APN 19 39639967 missense probably damaging 0.99
IGL01819:Cyp2c67 APN 19 39615721 missense probably damaging 0.98
IGL01902:Cyp2c67 APN 19 39649026 missense probably damaging 1.00
IGL02172:Cyp2c67 APN 19 39649002 missense possibly damaging 0.76
IGL02351:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02355:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02355:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02358:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02362:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02362:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02388:Cyp2c67 APN 19 39643355 missense probably benign 0.20
IGL03106:Cyp2c67 APN 19 39643675 missense probably benign 0.27
IGL03219:Cyp2c67 APN 19 39643294 missense possibly damaging 0.54
IGL03326:Cyp2c67 APN 19 39643269 critical splice donor site probably null
IGL03349:Cyp2c67 APN 19 39643684 missense probably damaging 1.00
IGL03356:Cyp2c67 APN 19 39639961 missense probably damaging 1.00
IGL03052:Cyp2c67 UTSW 19 39648885 missense possibly damaging 0.88
R0585:Cyp2c67 UTSW 19 39638694 missense possibly damaging 0.59
R0975:Cyp2c67 UTSW 19 39609178 missense possibly damaging 0.49
R0976:Cyp2c67 UTSW 19 39643374 missense probably damaging 1.00
R1252:Cyp2c67 UTSW 19 39626141 missense possibly damaging 0.93
R1398:Cyp2c67 UTSW 19 39638625 missense probably damaging 0.96
R1411:Cyp2c67 UTSW 19 39638591 missense probably damaging 1.00
R1505:Cyp2c67 UTSW 19 39648964 missense probably benign 0.00
R1543:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1613:Cyp2c67 UTSW 19 39626199 missense probably benign 0.00
R1618:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1667:Cyp2c67 UTSW 19 39643590 critical splice donor site probably null
R1852:Cyp2c67 UTSW 19 39617367 missense probably benign 0.01
R2005:Cyp2c67 UTSW 19 39643345 missense probably damaging 1.00
R2105:Cyp2c67 UTSW 19 39626237 missense probably benign 0.24
R2181:Cyp2c67 UTSW 19 39609097 missense possibly damaging 0.94
R3817:Cyp2c67 UTSW 19 39638683 missense probably benign 0.00
R4669:Cyp2c67 UTSW 19 39643654 missense probably benign 0.00
R4689:Cyp2c67 UTSW 19 39638588 missense probably benign 0.00
R4756:Cyp2c67 UTSW 19 39643744 missense probably benign 0.03
R4823:Cyp2c67 UTSW 19 39615724 missense probably benign 0.13
R5152:Cyp2c67 UTSW 19 39638688 missense probably benign 0.00
R5345:Cyp2c67 UTSW 19 39626232 missense probably benign 0.01
R5580:Cyp2c67 UTSW 19 39615650 missense probably damaging 0.99
R5644:Cyp2c67 UTSW 19 39615694 missense possibly damaging 0.84
R6116:Cyp2c67 UTSW 19 39617435 missense probably damaging 1.00
R6516:Cyp2c67 UTSW 19 39617429 missense probably damaging 1.00
R6550:Cyp2c67 UTSW 19 39617410 nonsense probably null
R6939:Cyp2c67 UTSW 19 39643334 missense possibly damaging 0.68
R6995:Cyp2c67 UTSW 19 39615679 missense probably damaging 0.96
R7028:Cyp2c67 UTSW 19 39639897 missense possibly damaging 0.68
R7144:Cyp2c67 UTSW 19 39615694 missense probably benign 0.00
R7242:Cyp2c67 UTSW 19 39617339 missense probably benign 0.30
R7335:Cyp2c67 UTSW 19 39640007 nonsense probably null
R7337:Cyp2c67 UTSW 19 39609264 splice site probably null
R7474:Cyp2c67 UTSW 19 39617432 missense probably null 0.05
R7642:Cyp2c67 UTSW 19 39615640 missense probably damaging 0.97
R7870:Cyp2c67 UTSW 19 39609225 missense probably damaging 1.00
R8152:Cyp2c67 UTSW 19 39640008 missense probably benign 0.21
R8367:Cyp2c67 UTSW 19 39638674 missense probably benign 0.01
R8728:Cyp2c67 UTSW 19 39626161 missense probably damaging 1.00
R9275:Cyp2c67 UTSW 19 39609255 missense probably damaging 1.00
R9278:Cyp2c67 UTSW 19 39609255 missense probably damaging 1.00
R9376:Cyp2c67 UTSW 19 39638734 missense probably damaging 1.00
Z1177:Cyp2c67 UTSW 19 39643679 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACTCTACAGTCCATGACAAGTC -3'
(R):5'- GGTTATTCAAACGTGTAGAACAGAG -3'

Sequencing Primer
(F):5'- AGTCCATGACAAGTCCATAATTTTAG -3'
(R):5'- ACACTCAAAAGATATGTGAGTGTG -3'
Posted On 2021-04-30