Incidental Mutation 'R8719:Ccdc150'
ID 669989
Institutional Source Beutler Lab
Gene Symbol Ccdc150
Ensembl Gene ENSMUSG00000025983
Gene Name coiled-coil domain containing 150
Synonyms 4930511H11Rik
MMRRC Submission 068614-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R8719 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 54289842-54407886 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 54302668 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 96 (P96Q)
Ref Sequence ENSEMBL: ENSMUSP00000027128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027128] [ENSMUST00000160472]
AlphaFold Q8CDI7
Predicted Effect probably benign
Transcript: ENSMUST00000027128
AA Change: P96Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027128
Gene: ENSMUSG00000025983
AA Change: P96Q

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 676 N/A INTRINSIC
coiled coil region 727 952 N/A INTRINSIC
coiled coil region 985 1048 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160472
AA Change: P96Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125195
Gene: ENSMUSG00000025983
AA Change: P96Q

DomainStartEndE-ValueType
coiled coil region 160 250 N/A INTRINSIC
coiled coil region 288 314 N/A INTRINSIC
coiled coil region 418 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T C 8: 46,966,700 (GRCm39) I224T probably benign Het
Adamts20 C G 15: 94,241,903 (GRCm39) A702P probably damaging Het
Ahdc1 T A 4: 132,791,533 (GRCm39) Y925N possibly damaging Het
Anapc1 T C 2: 128,483,369 (GRCm39) E1242G probably damaging Het
Angptl2 A G 2: 33,133,914 (GRCm39) N412S possibly damaging Het
Aox3 T C 1: 58,158,696 (GRCm39) V89A probably damaging Het
Atxn1l A T 8: 110,459,861 (GRCm39) S134T possibly damaging Het
Brf1 C A 12: 112,943,304 (GRCm39) probably benign Het
Cab39l A T 14: 59,734,314 (GRCm39) H11L probably benign Het
Cabcoco1 A G 10: 68,272,671 (GRCm39) probably benign Het
Chek2 T C 5: 111,014,908 (GRCm39) V459A probably damaging Het
Cntnap2 A T 6: 45,978,161 (GRCm39) D272V probably damaging Het
Cspp1 T C 1: 10,160,516 (GRCm39) S572P possibly damaging Het
Cysltr2 T C 14: 73,267,111 (GRCm39) T200A possibly damaging Het
Dglucy T C 12: 100,804,821 (GRCm39) L104P probably damaging Het
Dnah8 T A 17: 30,960,289 (GRCm39) M2222K probably damaging Het
Dync2h1 C A 9: 7,041,641 (GRCm39) V3334F probably benign Het
Ear2 A T 14: 44,340,734 (GRCm39) T131S possibly damaging Het
Eef1akmt2 A T 7: 132,452,340 (GRCm39) V92D probably damaging Het
Fam83c T A 2: 155,671,128 (GRCm39) Q769L probably benign Het
Fanca A T 8: 124,014,867 (GRCm39) C812S probably benign Het
Gm21663 T G 5: 26,146,162 (GRCm39) R50S probably damaging Het
Gm5591 T G 7: 38,221,614 (GRCm39) S152R probably benign Het
Gm6370 T G 5: 146,430,626 (GRCm39) D270E probably damaging Het
H2-T22 T C 17: 36,352,835 (GRCm39) I91V probably benign Het
Hdac5 T C 11: 102,097,963 (GRCm39) M61V probably benign Het
Hsd17b6 A G 10: 127,829,492 (GRCm39) S237P possibly damaging Het
Khk T A 5: 31,088,374 (GRCm39) F294I possibly damaging Het
Klc1 G A 12: 111,772,509 (GRCm39) probably benign Het
Lamb3 T C 1: 193,006,099 (GRCm39) W143R probably damaging Het
Lmo2 T C 2: 103,811,264 (GRCm39) I171T probably damaging Het
Meis1 A G 11: 18,835,587 (GRCm39) S344P probably benign Het
Nf1 C A 11: 79,281,119 (GRCm39) R125S possibly damaging Het
Nrcam A G 12: 44,586,325 (GRCm39) E105G probably benign Het
Nudt22 T C 19: 6,972,638 (GRCm39) D150G possibly damaging Het
Or14j8 T C 17: 38,263,895 (GRCm39) T7A probably damaging Het
Or5an1 A G 19: 12,260,792 (GRCm39) I127V probably benign Het
Or5b109 A G 19: 13,211,836 (GRCm39) Y74C probably damaging Het
Pclo A T 5: 14,763,778 (GRCm39) R799* probably null Het
Pelp1 T C 11: 70,292,789 (GRCm39) N175S probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Pik3r4 C A 9: 105,559,394 (GRCm39) S1162R probably benign Het
Pkd1l3 A T 8: 110,341,255 (GRCm39) N36I unknown Het
Pomk T A 8: 26,473,503 (GRCm39) Y150F possibly damaging Het
Rdh11 T A 12: 79,229,574 (GRCm39) H233L probably benign Het
Rln1 A T 19: 29,309,281 (GRCm39) M166K probably benign Het
Rnf40 T A 7: 127,191,834 (GRCm39) L356Q probably damaging Het
Sin3b G T 8: 73,450,139 (GRCm39) G19W unknown Het
Slc6a15 A G 10: 103,240,176 (GRCm39) R300G probably damaging Het
Sncaip A T 18: 53,027,910 (GRCm39) K433M probably damaging Het
Tead2 A T 7: 44,882,316 (GRCm39) probably benign Het
Tespa1 A G 10: 130,184,108 (GRCm39) D63G probably benign Het
Tmem117 T C 15: 94,992,248 (GRCm39) F303L probably damaging Het
Tmem270 T G 5: 134,930,650 (GRCm39) T204P probably damaging Het
Trip12 A G 1: 84,722,790 (GRCm39) V1320A probably damaging Het
Ttc7b A G 12: 100,267,812 (GRCm39) L843P probably damaging Het
Ttn T C 2: 76,543,041 (GRCm39) Y33315C probably damaging Het
Ttn A G 2: 76,607,146 (GRCm39) V17959A possibly damaging Het
Vmn2r73 A G 7: 85,521,095 (GRCm39) V291A probably damaging Het
Ywhag T A 5: 135,939,998 (GRCm39) T199S probably benign Het
Zfp810 T C 9: 22,190,571 (GRCm39) T77A probably benign Het
Other mutations in Ccdc150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Ccdc150 APN 1 54,311,709 (GRCm39) splice site probably benign
IGL00819:Ccdc150 APN 1 54,302,732 (GRCm39) missense probably damaging 1.00
IGL01973:Ccdc150 APN 1 54,339,647 (GRCm39) splice site probably null
IGL02352:Ccdc150 APN 1 54,311,680 (GRCm39) missense probably benign 0.25
IGL02359:Ccdc150 APN 1 54,311,680 (GRCm39) missense probably benign 0.25
IGL02620:Ccdc150 APN 1 54,302,704 (GRCm39) nonsense probably null
IGL02673:Ccdc150 APN 1 54,368,149 (GRCm39) missense probably benign 0.09
IGL03148:Ccdc150 APN 1 54,317,874 (GRCm39) missense possibly damaging 0.68
IGL03185:Ccdc150 APN 1 54,339,482 (GRCm39) missense probably damaging 1.00
IGL03014:Ccdc150 UTSW 1 54,329,861 (GRCm39) missense probably damaging 0.99
R0066:Ccdc150 UTSW 1 54,395,850 (GRCm39) missense probably benign
R0066:Ccdc150 UTSW 1 54,395,850 (GRCm39) missense probably benign
R0217:Ccdc150 UTSW 1 54,339,589 (GRCm39) missense possibly damaging 0.87
R0582:Ccdc150 UTSW 1 54,368,670 (GRCm39) missense probably benign
R0687:Ccdc150 UTSW 1 54,324,790 (GRCm39) splice site probably null
R0790:Ccdc150 UTSW 1 54,316,935 (GRCm39) splice site probably benign
R1146:Ccdc150 UTSW 1 54,404,130 (GRCm39) splice site probably benign
R1288:Ccdc150 UTSW 1 54,403,617 (GRCm39) missense probably damaging 1.00
R1763:Ccdc150 UTSW 1 54,393,795 (GRCm39) missense probably benign 0.42
R1855:Ccdc150 UTSW 1 54,407,069 (GRCm39) intron probably benign
R1957:Ccdc150 UTSW 1 54,303,068 (GRCm39) missense probably benign 0.00
R2180:Ccdc150 UTSW 1 54,311,706 (GRCm39) critical splice donor site probably null
R2226:Ccdc150 UTSW 1 54,404,084 (GRCm39) missense probably null 0.11
R3054:Ccdc150 UTSW 1 54,328,001 (GRCm39) missense possibly damaging 0.51
R3055:Ccdc150 UTSW 1 54,328,001 (GRCm39) missense possibly damaging 0.51
R3056:Ccdc150 UTSW 1 54,328,001 (GRCm39) missense possibly damaging 0.51
R3409:Ccdc150 UTSW 1 54,395,932 (GRCm39) missense probably benign 0.02
R3411:Ccdc150 UTSW 1 54,395,932 (GRCm39) missense probably benign 0.02
R3812:Ccdc150 UTSW 1 54,407,469 (GRCm39) missense probably benign 0.00
R4031:Ccdc150 UTSW 1 54,317,970 (GRCm39) missense probably benign 0.31
R4356:Ccdc150 UTSW 1 54,392,213 (GRCm39) missense probably damaging 0.98
R4617:Ccdc150 UTSW 1 54,394,913 (GRCm39) missense probably benign 0.00
R4757:Ccdc150 UTSW 1 54,317,874 (GRCm39) missense possibly damaging 0.81
R4957:Ccdc150 UTSW 1 54,404,027 (GRCm39) intron probably benign
R5028:Ccdc150 UTSW 1 54,302,636 (GRCm39) missense probably benign 0.01
R5512:Ccdc150 UTSW 1 54,393,806 (GRCm39) missense probably damaging 0.96
R5757:Ccdc150 UTSW 1 54,302,779 (GRCm39) missense probably damaging 1.00
R5943:Ccdc150 UTSW 1 54,339,526 (GRCm39) missense probably benign 0.01
R5948:Ccdc150 UTSW 1 54,316,873 (GRCm39) missense possibly damaging 0.79
R6033:Ccdc150 UTSW 1 54,324,787 (GRCm39) critical splice donor site probably null
R6033:Ccdc150 UTSW 1 54,324,787 (GRCm39) critical splice donor site probably null
R6065:Ccdc150 UTSW 1 54,302,758 (GRCm39) missense possibly damaging 0.90
R6390:Ccdc150 UTSW 1 54,407,176 (GRCm39) missense probably benign 0.01
R6399:Ccdc150 UTSW 1 54,303,116 (GRCm39) splice site probably null
R6988:Ccdc150 UTSW 1 54,394,868 (GRCm39) nonsense probably null
R7248:Ccdc150 UTSW 1 54,344,057 (GRCm39) missense probably benign 0.00
R7319:Ccdc150 UTSW 1 54,302,496 (GRCm39) splice site probably null
R7322:Ccdc150 UTSW 1 54,299,125 (GRCm39) missense probably benign 0.01
R7366:Ccdc150 UTSW 1 54,339,541 (GRCm39) nonsense probably null
R7647:Ccdc150 UTSW 1 54,395,863 (GRCm39) missense probably damaging 1.00
R7981:Ccdc150 UTSW 1 54,407,551 (GRCm39) missense probably damaging 1.00
R8002:Ccdc150 UTSW 1 54,311,656 (GRCm39) missense probably damaging 0.99
R8201:Ccdc150 UTSW 1 54,368,646 (GRCm39) missense probably benign 0.10
R8688:Ccdc150 UTSW 1 54,407,132 (GRCm39) missense probably damaging 1.00
R8963:Ccdc150 UTSW 1 54,311,641 (GRCm39) missense probably benign 0.14
R9178:Ccdc150 UTSW 1 54,311,644 (GRCm39) missense probably damaging 0.99
R9200:Ccdc150 UTSW 1 54,299,197 (GRCm39) missense probably damaging 1.00
R9332:Ccdc150 UTSW 1 54,316,910 (GRCm39) missense probably damaging 0.99
R9367:Ccdc150 UTSW 1 54,324,760 (GRCm39) missense probably damaging 1.00
R9416:Ccdc150 UTSW 1 54,317,990 (GRCm39) missense probably damaging 0.97
R9430:Ccdc150 UTSW 1 54,320,930 (GRCm39) missense probably damaging 1.00
R9576:Ccdc150 UTSW 1 54,407,544 (GRCm39) nonsense probably null
R9747:Ccdc150 UTSW 1 54,299,107 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCAATGTTGTTGCTGTCAC -3'
(R):5'- ATGAAGCACAGATTCACGGGC -3'

Sequencing Primer
(F):5'- GCTGTCACTTGCTATTCTAATTGG -3'
(R):5'- GATTCACGGGCCCACCAAG -3'
Posted On 2021-04-30