Incidental Mutation 'R8719:Trip12'
ID 669991
Institutional Source Beutler Lab
Gene Symbol Trip12
Ensembl Gene ENSMUSG00000026219
Gene Name thyroid hormone receptor interactor 12
Synonyms 6720416K24Rik, 1110036I07Rik, Gtl6
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8719 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 84721189-84840516 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84745069 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1320 (V1320A)
Ref Sequence ENSEMBL: ENSMUSP00000027421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000189670] [ENSMUST00000189841]
AlphaFold G5E870
Predicted Effect probably damaging
Transcript: ENSMUST00000027421
AA Change: V1320A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: V1320A

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 765 831 7.6e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185909
SMART Domains Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 195 214 N/A INTRINSIC
low complexity region 219 230 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 273 289 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186465
AA Change: V1320A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: V1320A

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
low complexity region 416 427 N/A INTRINSIC
SCOP:d1ee4a_ 446 660 5e-20 SMART
PDB:1WA5|B 447 641 1e-5 PDB
Pfam:WWE 761 831 2.2e-22 PFAM
low complexity region 983 1006 N/A INTRINSIC
low complexity region 1033 1047 N/A INTRINSIC
low complexity region 1062 1073 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 1345 1362 N/A INTRINSIC
Blast:HECTc 1363 1417 8e-8 BLAST
Blast:HECTc 1573 1629 2e-24 BLAST
HECTc 1636 2025 1.29e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186648
AA Change: V1287A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: V1287A

DomainStartEndE-ValueType
low complexity region 34 39 N/A INTRINSIC
low complexity region 153 172 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 191 215 N/A INTRINSIC
low complexity region 231 247 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
low complexity region 410 421 N/A INTRINSIC
SCOP:d1ee4a_ 440 654 5e-20 SMART
PDB:1WA5|B 441 635 1e-5 PDB
low complexity region 950 973 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1312 1329 N/A INTRINSIC
Blast:HECTc 1330 1384 7e-8 BLAST
Blast:HECTc 1540 1596 2e-24 BLAST
HECTc 1603 1992 6.2e-180 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189670
AA Change: V125A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140789
Gene: ENSMUSG00000026219
AA Change: V125A

DomainStartEndE-ValueType
low complexity region 138 149 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
Blast:HECTc 168 222 5e-8 BLAST
Blast:HECTc 378 434 1e-24 BLAST
HECTc 441 830 6.2e-180 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189841
SMART Domains Protein: ENSMUSP00000140879
Gene: ENSMUSG00000026219

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 51 63 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T C 8: 46,513,663 I224T probably benign Het
Adamts20 C G 15: 94,344,022 A702P probably damaging Het
Ahdc1 T A 4: 133,064,222 Y925N possibly damaging Het
Anapc1 T C 2: 128,641,449 E1242G probably damaging Het
Angptl2 A G 2: 33,243,902 N412S possibly damaging Het
Aox3 T C 1: 58,119,537 V89A probably damaging Het
Atxn1l A T 8: 109,733,229 S134T possibly damaging Het
Brf1 C A 12: 112,979,684 probably benign Het
Cab39l A T 14: 59,496,865 H11L probably benign Het
Cabcoco1 A G 10: 68,436,841 probably benign Het
Ccdc150 C A 1: 54,263,509 P96Q probably benign Het
Chek2 T C 5: 110,867,042 V459A probably damaging Het
Cntnap2 A T 6: 46,001,227 D272V probably damaging Het
Cspp1 T C 1: 10,090,291 S572P possibly damaging Het
Cysltr2 T C 14: 73,029,671 T200A possibly damaging Het
Dglucy T C 12: 100,838,562 L104P probably damaging Het
Dnah8 T A 17: 30,741,315 M2222K probably damaging Het
Dync2h1 C A 9: 7,041,641 V3334F probably benign Het
Ear2 A T 14: 44,103,277 T131S possibly damaging Het
Eef1akmt2 A T 7: 132,850,611 V92D probably damaging Het
Fam83c T A 2: 155,829,208 Q769L probably benign Het
Fanca A T 8: 123,288,128 C812S probably benign Het
Gm21663 T G 5: 25,941,164 R50S probably damaging Het
Gm5591 T G 7: 38,522,190 S152R probably benign Het
Gm6370 T G 5: 146,493,816 D270E probably damaging Het
H2-T22 T C 17: 36,041,943 I91V probably benign Het
Hdac5 T C 11: 102,207,137 M61V probably benign Het
Hsd17b6 A G 10: 127,993,623 S237P possibly damaging Het
Khk T A 5: 30,931,030 F294I possibly damaging Het
Klc1 G A 12: 111,806,075 probably benign Het
Lamb3 T C 1: 193,323,791 W143R probably damaging Het
Lmo2 T C 2: 103,980,919 I171T probably damaging Het
Meis1 A G 11: 18,885,587 S344P probably benign Het
Nf1 C A 11: 79,390,293 R125S possibly damaging Het
Nrcam A G 12: 44,539,542 E105G probably benign Het
Nudt22 T C 19: 6,995,270 D150G possibly damaging Het
Olfr1434 A G 19: 12,283,428 I127V probably benign Het
Olfr1463 A G 19: 13,234,472 Y74C probably damaging Het
Olfr761 T C 17: 37,953,004 T7A probably damaging Het
Pclo A T 5: 14,713,764 R799* probably null Het
Pelp1 T C 11: 70,401,963 N175S probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pik3r4 C A 9: 105,682,195 S1162R probably benign Het
Pkd1l3 A T 8: 109,614,623 N36I unknown Het
Pomk T A 8: 25,983,475 Y150F possibly damaging Het
Rdh11 T A 12: 79,182,800 H233L probably benign Het
Rln1 A T 19: 29,331,881 M166K probably benign Het
Rnf40 T A 7: 127,592,662 L356Q probably damaging Het
Sin3b G T 8: 72,723,511 G19W unknown Het
Slc6a15 A G 10: 103,404,315 R300G probably damaging Het
Sncaip A T 18: 52,894,838 K433M probably damaging Het
Tead2 A T 7: 45,232,892 probably benign Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Tmem117 T C 15: 95,094,367 F303L probably damaging Het
Tmem270 T G 5: 134,901,796 T204P probably damaging Het
Ttc7b A G 12: 100,301,553 L843P probably damaging Het
Ttn T C 2: 76,712,697 Y33315C probably damaging Het
Ttn A G 2: 76,776,802 V17959A possibly damaging Het
Vmn2r73 A G 7: 85,871,887 V291A probably damaging Het
Ywhag T A 5: 135,911,144 T199S probably benign Het
Zfp810 T C 9: 22,279,275 T77A probably benign Het
Other mutations in Trip12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Trip12 APN 1 84730541 missense probably damaging 1.00
IGL00430:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00465:Trip12 APN 1 84763861 missense probably damaging 0.96
IGL00819:Trip12 APN 1 84754272 missense probably damaging 1.00
IGL00900:Trip12 APN 1 84724764 missense possibly damaging 0.56
IGL00990:Trip12 APN 1 84751884 missense probably damaging 0.99
IGL01087:Trip12 APN 1 84757859 missense probably damaging 0.99
IGL01400:Trip12 APN 1 84751978 missense probably damaging 0.99
IGL01521:Trip12 APN 1 84766198 splice site probably benign
IGL01619:Trip12 APN 1 84814910 missense probably damaging 0.99
IGL01796:Trip12 APN 1 84728278 missense probably benign 0.42
IGL01975:Trip12 APN 1 84814813 splice site probably benign
IGL02190:Trip12 APN 1 84766070 missense probably damaging 0.98
IGL02474:Trip12 APN 1 84794133 missense probably benign
IGL02517:Trip12 APN 1 84743814 unclassified probably benign
IGL02631:Trip12 APN 1 84766008 missense possibly damaging 0.91
IGL02991:Trip12 APN 1 84738815 missense probably damaging 1.00
IGL03161:Trip12 APN 1 84761132 unclassified probably benign
IGL03388:Trip12 APN 1 84743186 missense probably damaging 0.99
cardamom UTSW 1 84749276 missense probably damaging 0.99
pungent UTSW 1 84793915 missense possibly damaging 0.70
spices UTSW 1 84793875 missense probably benign 0.10
sulfuric UTSW 1 84759050 missense probably benign 0.19
Turmeric UTSW 1 84754343 missense probably benign 0.07
LCD18:Trip12 UTSW 1 84754482 unclassified probably benign
R0090:Trip12 UTSW 1 84732136 splice site probably benign
R0111:Trip12 UTSW 1 84759133 unclassified probably benign
R0471:Trip12 UTSW 1 84726207 missense probably damaging 1.00
R0486:Trip12 UTSW 1 84761084 nonsense probably null
R0557:Trip12 UTSW 1 84724747 missense probably damaging 1.00
R0570:Trip12 UTSW 1 84751548 missense probably damaging 1.00
R0614:Trip12 UTSW 1 84757761 missense probably damaging 1.00
R0627:Trip12 UTSW 1 84768597 missense probably damaging 1.00
R0630:Trip12 UTSW 1 84793915 missense possibly damaging 0.70
R0657:Trip12 UTSW 1 84759050 missense probably benign 0.19
R0741:Trip12 UTSW 1 84745181 missense probably benign 0.09
R0862:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R0864:Trip12 UTSW 1 84744009 missense probably damaging 0.99
R1124:Trip12 UTSW 1 84737037 missense probably damaging 1.00
R1252:Trip12 UTSW 1 84776350 nonsense probably null
R1455:Trip12 UTSW 1 84759100 missense probably benign 0.01
R1487:Trip12 UTSW 1 84768631 missense probably damaging 1.00
R1702:Trip12 UTSW 1 84745063 missense probably damaging 1.00
R1781:Trip12 UTSW 1 84730621 missense probably benign 0.01
R1847:Trip12 UTSW 1 84749269 missense probably damaging 1.00
R1854:Trip12 UTSW 1 84728145 missense probably damaging 1.00
R1866:Trip12 UTSW 1 84745060 missense probably damaging 1.00
R1926:Trip12 UTSW 1 84749291 missense probably damaging 0.98
R1935:Trip12 UTSW 1 84794101 missense possibly damaging 0.46
R1950:Trip12 UTSW 1 84760801 missense probably damaging 1.00
R1994:Trip12 UTSW 1 84749172 missense probably damaging 1.00
R2014:Trip12 UTSW 1 84760866 nonsense probably null
R2391:Trip12 UTSW 1 84814790 frame shift probably null
R2423:Trip12 UTSW 1 84814790 frame shift probably null
R2433:Trip12 UTSW 1 84743823 missense possibly damaging 0.84
R2905:Trip12 UTSW 1 84754343 missense probably benign 0.07
R3040:Trip12 UTSW 1 84742245 missense probably benign 0.13
R3735:Trip12 UTSW 1 84814790 frame shift probably null
R3907:Trip12 UTSW 1 84732106 missense possibly damaging 0.53
R4394:Trip12 UTSW 1 84725741 missense probably damaging 1.00
R4540:Trip12 UTSW 1 84749276 missense probably damaging 0.99
R4859:Trip12 UTSW 1 84793810 missense probably damaging 0.99
R5240:Trip12 UTSW 1 84794133 missense probably benign
R5278:Trip12 UTSW 1 84762147 missense probably damaging 1.00
R5377:Trip12 UTSW 1 84757431 missense probably damaging 1.00
R5510:Trip12 UTSW 1 84768680 missense probably damaging 1.00
R5542:Trip12 UTSW 1 84749344 missense probably damaging 1.00
R5550:Trip12 UTSW 1 84761099 missense probably damaging 0.99
R5886:Trip12 UTSW 1 84730458 intron probably benign
R5893:Trip12 UTSW 1 84759163 unclassified probably benign
R5914:Trip12 UTSW 1 84763458 missense probably damaging 1.00
R5925:Trip12 UTSW 1 84749253 nonsense probably null
R5985:Trip12 UTSW 1 84725771 missense probably damaging 0.99
R6135:Trip12 UTSW 1 84760838 missense probably benign 0.00
R6158:Trip12 UTSW 1 84761012 missense possibly damaging 0.84
R6419:Trip12 UTSW 1 84793870 missense probably damaging 1.00
R6816:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7144:Trip12 UTSW 1 84793714 missense probably damaging 0.99
R7194:Trip12 UTSW 1 84794222 missense probably benign 0.07
R7355:Trip12 UTSW 1 84814883 missense probably damaging 1.00
R7361:Trip12 UTSW 1 84750442 missense probably damaging 0.98
R7588:Trip12 UTSW 1 84760883 missense probably damaging 0.99
R7705:Trip12 UTSW 1 84777449 missense probably damaging 1.00
R7818:Trip12 UTSW 1 84760806 missense probably damaging 1.00
R7918:Trip12 UTSW 1 84745063 missense probably damaging 0.98
R8127:Trip12 UTSW 1 84738742 missense probably damaging 0.99
R8221:Trip12 UTSW 1 84766050 missense possibly damaging 0.80
R8336:Trip12 UTSW 1 84766041 missense probably benign 0.37
R8373:Trip12 UTSW 1 84795767 missense probably damaging 0.98
R8771:Trip12 UTSW 1 84743297 unclassified probably benign
R8997:Trip12 UTSW 1 84793875 missense probably benign 0.10
R9146:Trip12 UTSW 1 84794160 missense possibly damaging 0.89
R9236:Trip12 UTSW 1 84725829 missense probably damaging 1.00
R9338:Trip12 UTSW 1 84749298 missense probably damaging 0.99
R9391:Trip12 UTSW 1 84795752 missense probably benign 0.00
R9516:Trip12 UTSW 1 84757494 missense probably damaging 1.00
X0023:Trip12 UTSW 1 84760787 missense probably benign 0.12
X0065:Trip12 UTSW 1 84749163 missense probably benign 0.21
Z1088:Trip12 UTSW 1 84766168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACCAGAGGTTCCTACAAC -3'
(R):5'- GGCTAGAGATCATGTTCATTTCATGC -3'

Sequencing Primer
(F):5'- ACAACCTAAAGTTTATGAAGAACAGC -3'
(R):5'- GCTTTTCATATGCAGAAAAACCGAC -3'
Posted On 2021-04-30