Incidental Mutation 'R8719:Angptl2'
ID669994
Institutional Source Beutler Lab
Gene Symbol Angptl2
Ensembl Gene ENSMUSG00000004105
Gene Nameangiopoietin-like 2
SynonymsArp2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R8719 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location33216069-33247717 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33243902 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 412 (N412S)
Ref Sequence ENSEMBL: ENSMUSP00000004208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004208] [ENSMUST00000042615] [ENSMUST00000091039] [ENSMUST00000113165] [ENSMUST00000131298] [ENSMUST00000193373]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004208
AA Change: N412S

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000004208
Gene: ENSMUSG00000004105
AA Change: N412S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 77 113 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 205 228 N/A INTRINSIC
FBG 273 488 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000042615
SMART Domains Protein: ENSMUSP00000048451
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 273 4.59e-86 SMART
low complexity region 286 301 N/A INTRINSIC
PH 372 485 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091039
SMART Domains Protein: ENSMUSP00000088563
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 460 573 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113165
SMART Domains Protein: ENSMUSP00000108790
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
PH 459 572 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131298
SMART Domains Protein: ENSMUSP00000118363
Gene: ENSMUSG00000038831

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
RasGEF 46 290 7.54e-105 SMART
low complexity region 303 318 N/A INTRINSIC
PH 390 503 1.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193373
SMART Domains Protein: ENSMUSP00000142084
Gene: ENSMUSG00000004105

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Fibrinogen_C 49 112 4.2e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. ANGPTL2 protein is a secreted glycoprotein with homology to the angiopoietins and may exert a function on endothelial cells through autocrine or paracrine action. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed a high-fat diet, mice homozygous for a knock-out allele show decreased weight gain, reduced adipocity, a lower respiratory quotient, reduced inflammation in adipose tissues, enhanced glucose tolerance, and increased insulin sensitivity in both skeletal muscle and liver relative to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T C 8: 46,513,663 I224T probably benign Het
Adamts20 C G 15: 94,344,022 A702P probably damaging Het
Ahdc1 T A 4: 133,064,222 Y925N possibly damaging Het
Anapc1 T C 2: 128,641,449 E1242G probably damaging Het
Aox3 T C 1: 58,119,537 V89A probably damaging Het
Atp2b4 CTTCTT CTTCTTTTTCTT 1: 133,701,735 probably benign Het
Atxn1l A T 8: 109,733,229 S134T possibly damaging Het
Brf1 C A 12: 112,979,684 probably benign Het
Cab39l A T 14: 59,496,865 H11L probably benign Het
Cabcoco1 A G 10: 68,436,841 probably benign Het
Ccdc150 C A 1: 54,263,509 P96Q probably benign Het
Chek2 T C 5: 110,867,042 V459A probably damaging Het
Cntnap2 A T 6: 46,001,227 D272V probably damaging Het
Cspp1 T C 1: 10,090,291 S572P possibly damaging Het
Cysltr2 T C 14: 73,029,671 T200A possibly damaging Het
Dglucy T C 12: 100,838,562 L104P probably damaging Het
Dnah8 T A 17: 30,741,315 M2222K probably damaging Het
Dync2h1 C A 9: 7,041,641 V3334F probably benign Het
Ear2 A T 14: 44,103,277 T131S possibly damaging Het
Eef1akmt2 A T 7: 132,850,611 V92D probably damaging Het
Fam83c T A 2: 155,829,208 Q769L probably benign Het
Fanca A T 8: 123,288,128 C812S probably benign Het
Gm21663 T G 5: 25,941,164 R50S probably damaging Het
Gm5591 T G 7: 38,522,190 S152R probably benign Het
Gm6370 T G 5: 146,493,816 D270E probably damaging Het
H2-T22 T C 17: 36,041,943 I91V probably benign Het
Hdac5 T C 11: 102,207,137 M61V probably benign Het
Hsd17b6 A G 10: 127,993,623 S237P possibly damaging Het
Khk T A 5: 30,931,030 F294I possibly damaging Het
Klc1 G A 12: 111,806,075 probably benign Het
Lamb3 T C 1: 193,323,791 W143R probably damaging Het
Lmo2 T C 2: 103,980,919 I171T probably damaging Het
Meis1 A G 11: 18,885,587 S344P probably benign Het
Nf1 C A 11: 79,390,293 R125S possibly damaging Het
Nrcam A G 12: 44,539,542 E105G probably benign Het
Nudt22 T C 19: 6,995,270 D150G possibly damaging Het
Olfr1434 A G 19: 12,283,428 I127V probably benign Het
Olfr1463 A G 19: 13,234,472 Y74C probably damaging Het
Olfr761 T C 17: 37,953,004 T7A probably damaging Het
Pclo A T 5: 14,713,764 R799* probably null Het
Pelp1 T C 11: 70,401,963 N175S probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pik3r4 C A 9: 105,682,195 S1162R probably benign Het
Pkd1l3 A T 8: 109,614,623 N36I unknown Het
Pomk T A 8: 25,983,475 Y150F possibly damaging Het
Rdh11 T A 12: 79,182,800 H233L probably benign Het
Rln1 A T 19: 29,331,881 M166K probably benign Het
Rnf40 T A 7: 127,592,662 L356Q probably damaging Het
Sin3b G T 8: 72,723,511 G19W unknown Het
Slc6a15 A G 10: 103,404,315 R300G probably damaging Het
Sncaip A T 18: 52,894,838 K433M probably damaging Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Tmem117 T C 15: 95,094,367 F303L probably damaging Het
Tmem270 T G 5: 134,901,796 T204P probably damaging Het
Trip12 A G 1: 84,745,069 V1320A probably damaging Het
Ttc7b A G 12: 100,301,553 L843P probably damaging Het
Ttn T C 2: 76,712,697 Y33315C probably damaging Het
Ttn A G 2: 76,776,802 V17959A possibly damaging Het
Vmn2r73 A G 7: 85,871,887 V291A probably damaging Het
Ywhag T A 5: 135,911,144 T199S probably benign Het
Zfp810 T C 9: 22,279,275 T77A probably benign Het
Other mutations in Angptl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Angptl2 APN 2 33228394 missense probably damaging 1.00
IGL00585:Angptl2 APN 2 33246227 missense probably damaging 0.98
IGL00900:Angptl2 APN 2 33243772 missense probably benign 0.00
IGL01521:Angptl2 APN 2 33246203 missense probably damaging 1.00
IGL02711:Angptl2 APN 2 33228243 missense probably benign 0.00
IGL02826:Angptl2 APN 2 33228315 missense probably benign 0.19
grazie UTSW 2 33243910 nonsense probably null
R1309:Angptl2 UTSW 2 33246128 missense probably benign 0.38
R1541:Angptl2 UTSW 2 33246165 missense probably benign 0.26
R1542:Angptl2 UTSW 2 33228885 missense probably benign 0.24
R1604:Angptl2 UTSW 2 33243773 missense possibly damaging 0.89
R3432:Angptl2 UTSW 2 33228802 missense probably benign 0.02
R4331:Angptl2 UTSW 2 33228748 missense probably damaging 0.99
R4652:Angptl2 UTSW 2 33243883 missense probably damaging 1.00
R4741:Angptl2 UTSW 2 33246188 missense probably benign 0.12
R5107:Angptl2 UTSW 2 33228603 missense probably damaging 0.98
R5504:Angptl2 UTSW 2 33229038 intron probably benign
R5694:Angptl2 UTSW 2 33228616 missense probably damaging 1.00
R5967:Angptl2 UTSW 2 33228706 missense probably damaging 1.00
R6185:Angptl2 UTSW 2 33229014 missense probably benign 0.00
R6797:Angptl2 UTSW 2 33228265 missense probably benign 0.00
R7151:Angptl2 UTSW 2 33243910 nonsense probably null
R7471:Angptl2 UTSW 2 33243739 missense possibly damaging 0.89
R7742:Angptl2 UTSW 2 33243916 missense probably damaging 1.00
R7763:Angptl2 UTSW 2 33242382 nonsense probably null
R8928:Angptl2 UTSW 2 33242304 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CAGCAAGGGTTTGGGAACATC -3'
(R):5'- GAAGGACTTGGTAAAGCTGCC -3'

Sequencing Primer
(F):5'- CTGGAGAACATCTACTGGCTGAC -3'
(R):5'- TTGGTAAAGCTGCCTGACAC -3'
Posted On2021-04-30