Incidental Mutation 'R8719:Fam83c'
ID 669999
Institutional Source Beutler Lab
Gene Symbol Fam83c
Ensembl Gene ENSMUSG00000074647
Gene Name family with sequence similarity 83, member C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R8719 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 155827548-155834854 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 155829208 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 769 (Q769L)
Ref Sequence ENSEMBL: ENSMUSP00000029143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029142] [ENSMUST00000029143] [ENSMUST00000109638] [ENSMUST00000129830] [ENSMUST00000134278] [ENSMUST00000154841]
AlphaFold A2ARK0
Predicted Effect probably benign
Transcript: ENSMUST00000029142
SMART Domains Protein: ENSMUSP00000029142
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
eIF6 3 204 2.72e-136 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000029143
AA Change: Q769L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029143
Gene: ENSMUSG00000074647
AA Change: Q769L

DomainStartEndE-ValueType
Pfam:DUF1669 61 337 3.1e-107 PFAM
low complexity region 347 357 N/A INTRINSIC
low complexity region 368 385 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
low complexity region 474 484 N/A INTRINSIC
low complexity region 570 589 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109638
SMART Domains Protein: ENSMUSP00000105266
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
Pfam:eIF-6 3 70 1.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129830
SMART Domains Protein: ENSMUSP00000120206
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
eIF6 3 68 4.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134278
SMART Domains Protein: ENSMUSP00000123190
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
Pfam:eIF-6 1 58 5.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154841
SMART Domains Protein: ENSMUSP00000115715
Gene: ENSMUSG00000027613

DomainStartEndE-ValueType
Pfam:eIF-6 3 45 7.8e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T C 8: 46,513,663 I224T probably benign Het
Adamts20 C G 15: 94,344,022 A702P probably damaging Het
Ahdc1 T A 4: 133,064,222 Y925N possibly damaging Het
Anapc1 T C 2: 128,641,449 E1242G probably damaging Het
Angptl2 A G 2: 33,243,902 N412S possibly damaging Het
Aox3 T C 1: 58,119,537 V89A probably damaging Het
Atxn1l A T 8: 109,733,229 S134T possibly damaging Het
Brf1 C A 12: 112,979,684 probably benign Het
Cab39l A T 14: 59,496,865 H11L probably benign Het
Cabcoco1 A G 10: 68,436,841 probably benign Het
Ccdc150 C A 1: 54,263,509 P96Q probably benign Het
Chek2 T C 5: 110,867,042 V459A probably damaging Het
Cntnap2 A T 6: 46,001,227 D272V probably damaging Het
Cspp1 T C 1: 10,090,291 S572P possibly damaging Het
Cysltr2 T C 14: 73,029,671 T200A possibly damaging Het
Dglucy T C 12: 100,838,562 L104P probably damaging Het
Dnah8 T A 17: 30,741,315 M2222K probably damaging Het
Dync2h1 C A 9: 7,041,641 V3334F probably benign Het
Ear2 A T 14: 44,103,277 T131S possibly damaging Het
Eef1akmt2 A T 7: 132,850,611 V92D probably damaging Het
Fanca A T 8: 123,288,128 C812S probably benign Het
Gm21663 T G 5: 25,941,164 R50S probably damaging Het
Gm5591 T G 7: 38,522,190 S152R probably benign Het
Gm6370 T G 5: 146,493,816 D270E probably damaging Het
H2-T22 T C 17: 36,041,943 I91V probably benign Het
Hdac5 T C 11: 102,207,137 M61V probably benign Het
Hsd17b6 A G 10: 127,993,623 S237P possibly damaging Het
Khk T A 5: 30,931,030 F294I possibly damaging Het
Klc1 G A 12: 111,806,075 probably benign Het
Lamb3 T C 1: 193,323,791 W143R probably damaging Het
Lmo2 T C 2: 103,980,919 I171T probably damaging Het
Meis1 A G 11: 18,885,587 S344P probably benign Het
Nf1 C A 11: 79,390,293 R125S possibly damaging Het
Nrcam A G 12: 44,539,542 E105G probably benign Het
Nudt22 T C 19: 6,995,270 D150G possibly damaging Het
Olfr1434 A G 19: 12,283,428 I127V probably benign Het
Olfr1463 A G 19: 13,234,472 Y74C probably damaging Het
Olfr761 T C 17: 37,953,004 T7A probably damaging Het
Pclo A T 5: 14,713,764 R799* probably null Het
Pelp1 T C 11: 70,401,963 N175S probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pik3r4 C A 9: 105,682,195 S1162R probably benign Het
Pkd1l3 A T 8: 109,614,623 N36I unknown Het
Pomk T A 8: 25,983,475 Y150F possibly damaging Het
Rdh11 T A 12: 79,182,800 H233L probably benign Het
Rln1 A T 19: 29,331,881 M166K probably benign Het
Rnf40 T A 7: 127,592,662 L356Q probably damaging Het
Sin3b G T 8: 72,723,511 G19W unknown Het
Slc6a15 A G 10: 103,404,315 R300G probably damaging Het
Sncaip A T 18: 52,894,838 K433M probably damaging Het
Tead2 A T 7: 45,232,892 probably benign Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Tmem117 T C 15: 95,094,367 F303L probably damaging Het
Tmem270 T G 5: 134,901,796 T204P probably damaging Het
Trip12 A G 1: 84,745,069 V1320A probably damaging Het
Ttc7b A G 12: 100,301,553 L843P probably damaging Het
Ttn T C 2: 76,712,697 Y33315C probably damaging Het
Ttn A G 2: 76,776,802 V17959A possibly damaging Het
Vmn2r73 A G 7: 85,871,887 V291A probably damaging Het
Ywhag T A 5: 135,911,144 T199S probably benign Het
Zfp810 T C 9: 22,279,275 T77A probably benign Het
Other mutations in Fam83c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Fam83c APN 2 155834442 missense probably damaging 1.00
IGL01470:Fam83c APN 2 155834808 missense possibly damaging 0.73
IGL02695:Fam83c APN 2 155831515 missense probably benign 0.04
R0255:Fam83c UTSW 2 155829752 missense probably benign 0.00
R0321:Fam83c UTSW 2 155829700 missense probably benign
R0449:Fam83c UTSW 2 155830295 missense probably benign 0.00
R1596:Fam83c UTSW 2 155831062 critical splice acceptor site probably null
R1635:Fam83c UTSW 2 155830051 missense possibly damaging 0.95
R2006:Fam83c UTSW 2 155830303 missense probably benign 0.04
R2165:Fam83c UTSW 2 155831524 missense possibly damaging 0.94
R3840:Fam83c UTSW 2 155834748 missense probably benign
R3841:Fam83c UTSW 2 155834748 missense probably benign
R4693:Fam83c UTSW 2 155830234 missense probably damaging 1.00
R5660:Fam83c UTSW 2 155829589 missense probably benign 0.08
R6364:Fam83c UTSW 2 155834523 missense probably damaging 1.00
R6563:Fam83c UTSW 2 155830952 missense probably damaging 0.98
R6976:Fam83c UTSW 2 155830237 missense possibly damaging 0.63
R7124:Fam83c UTSW 2 155829571 missense probably benign 0.00
R7643:Fam83c UTSW 2 155831004 missense possibly damaging 0.93
R8088:Fam83c UTSW 2 155831639 missense probably damaging 0.98
R8113:Fam83c UTSW 2 155834820 missense probably benign 0.33
R8212:Fam83c UTSW 2 155829287 missense probably benign 0.00
R8710:Fam83c UTSW 2 155829722 missense probably benign 0.01
R9194:Fam83c UTSW 2 155829379 missense probably damaging 1.00
R9549:Fam83c UTSW 2 155834752 missense
R9642:Fam83c UTSW 2 155831060 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTCAGTAACTGTGGTGTGTTC -3'
(R):5'- CAAGTATCATCAGCTGCAGGG -3'

Sequencing Primer
(F):5'- TGTGTGTAAAAGAGTCTTGAGACC -3'
(R):5'- ATCAGCTGCAGGGTGCCAG -3'
Posted On 2021-04-30