Incidental Mutation 'R0568:Rbpms2'
ID 67000
Institutional Source Beutler Lab
Gene Symbol Rbpms2
Ensembl Gene ENSMUSG00000032387
Gene Name RNA binding protein with multiple splicing 2
Synonyms 2400008B06Rik
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0568 (G1)
Quality Score 217
Status Validated
Chromosome 9
Chromosomal Location 65629648-65660528 bp(+) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) ACTGCTGCTGCTGCTGC to ACTGCTGCTGCTGCTGCTGC at 65651666 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055844] [ENSMUST00000169003] [ENSMUST00000216342] [ENSMUST00000216382]
AlphaFold Q8VC52
Predicted Effect probably benign
Transcript: ENSMUST00000055844
SMART Domains Protein: ENSMUSP00000057600
Gene: ENSMUSG00000032387

RRM 26 98 7.84e-8 SMART
low complexity region 172 182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169003
SMART Domains Protein: ENSMUSP00000131076
Gene: ENSMUSG00000032387

RRM 26 98 7.84e-8 SMART
low complexity region 135 144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213927
Predicted Effect probably benign
Transcript: ENSMUST00000216342
Predicted Effect probably benign
Transcript: ENSMUST00000216382
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RNA recognition motif (RRM)-containing protein family and is involved in the development and dedifferentiation of digestive smooth muscle cells. The encoded protein functions as a homodimer and indirectly inhibits the bone morphogenetic protein pathway. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Rbpms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0018:Rbpms2 UTSW 9 65651078 missense probably damaging 1.00
R0018:Rbpms2 UTSW 9 65651078 missense probably damaging 1.00
R0567:Rbpms2 UTSW 9 65651666 unclassified probably benign
R0570:Rbpms2 UTSW 9 65659194 nonsense probably null
R0727:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1374:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1375:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1377:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1390:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1412:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1662:Rbpms2 UTSW 9 65651042 missense probably benign 0.05
R1710:Rbpms2 UTSW 9 65659212 splice site probably benign
R1714:Rbpms2 UTSW 9 65651665 unclassified probably benign
R1714:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1715:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1838:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1838:Rbpms2 UTSW 9 65651680 unclassified probably benign
R1839:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1882:Rbpms2 UTSW 9 65651666 unclassified probably benign
R2088:Rbpms2 UTSW 9 65630839 missense probably damaging 0.99
R2118:Rbpms2 UTSW 9 65650947 missense probably damaging 1.00
R2237:Rbpms2 UTSW 9 65651611 nonsense probably null
R4633:Rbpms2 UTSW 9 65651636 missense probably benign 0.02
R7249:Rbpms2 UTSW 9 65649350 missense probably damaging 1.00
R8277:Rbpms2 UTSW 9 65649413 missense probably damaging 1.00
R8445:Rbpms2 UTSW 9 65651021 missense possibly damaging 0.81
R8902:Rbpms2 UTSW 9 65651069 missense probably benign 0.39
Predicted Primers
Posted On 2013-08-20