Mutagenetix > Incidental Mutation

Incidental Mutation 'R8719:Cntnap2'

670009

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8719 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 46001227 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 272 (D272V)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000114641
AA Change: D272V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: D272V

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl1	T	C	8: 46,513,663	I224T	probably benign	Het
Adamts20	C	G	15: 94,344,022	A702P	probably damaging	Het
Ahdc1	T	A	4: 133,064,222	Y925N	possibly damaging	Het
Anapc1	T	C	2: 128,641,449	E1242G	probably damaging	Het
Angptl2	A	G	2: 33,243,902	N412S	possibly damaging	Het
Aox3	T	C	1: 58,119,537	V89A	probably damaging	Het
Atxn1l	A	T	8: 109,733,229	S134T	possibly damaging	Het
Brf1	C	A	12: 112,979,684		probably benign	Het
Cab39l	A	T	14: 59,496,865	H11L	probably benign	Het
Cabcoco1	A	G	10: 68,436,841		probably benign	Het
Ccdc150	C	A	1: 54,263,509	P96Q	probably benign	Het
Chek2	T	C	5: 110,867,042	V459A	probably damaging	Het
Cspp1	T	C	1: 10,090,291	S572P	possibly damaging	Het
Cysltr2	T	C	14: 73,029,671	T200A	possibly damaging	Het
Dglucy	T	C	12: 100,838,562	L104P	probably damaging	Het
Dnah8	T	A	17: 30,741,315	M2222K	probably damaging	Het
Dync2h1	C	A	9: 7,041,641	V3334F	probably benign	Het
Ear2	A	T	14: 44,103,277	T131S	possibly damaging	Het
Eef1akmt2	A	T	7: 132,850,611	V92D	probably damaging	Het
Fam83c	T	A	2: 155,829,208	Q769L	probably benign	Het
Fanca	A	T	8: 123,288,128	C812S	probably benign	Het
Gm21663	T	G	5: 25,941,164	R50S	probably damaging	Het
Gm5591	T	G	7: 38,522,190	S152R	probably benign	Het
Gm6370	T	G	5: 146,493,816	D270E	probably damaging	Het
H2-T22	T	C	17: 36,041,943	I91V	probably benign	Het
Hdac5	T	C	11: 102,207,137	M61V	probably benign	Het
Hsd17b6	A	G	10: 127,993,623	S237P	possibly damaging	Het
Khk	T	A	5: 30,931,030	F294I	possibly damaging	Het
Klc1	G	A	12: 111,806,075		probably benign	Het
Lamb3	T	C	1: 193,323,791	W143R	probably damaging	Het
Lmo2	T	C	2: 103,980,919	I171T	probably damaging	Het
Meis1	A	G	11: 18,885,587	S344P	probably benign	Het
Nf1	C	A	11: 79,390,293	R125S	possibly damaging	Het
Nrcam	A	G	12: 44,539,542	E105G	probably benign	Het
Nudt22	T	C	19: 6,995,270	D150G	possibly damaging	Het
Olfr1434	A	G	19: 12,283,428	I127V	probably benign	Het
Olfr1463	A	G	19: 13,234,472	Y74C	probably damaging	Het
Olfr761	T	C	17: 37,953,004	T7A	probably damaging	Het
Pclo	A	T	5: 14,713,764	R799*	probably null	Het
Pelp1	T	C	11: 70,401,963	N175S	probably damaging	Het
Perm1	TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT	TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT	4: 156,218,068		probably benign	Het
Pik3r4	C	A	9: 105,682,195	S1162R	probably benign	Het
Pkd1l3	A	T	8: 109,614,623	N36I	unknown	Het
Pomk	T	A	8: 25,983,475	Y150F	possibly damaging	Het
Rdh11	T	A	12: 79,182,800	H233L	probably benign	Het
Rln1	A	T	19: 29,331,881	M166K	probably benign	Het
Rnf40	T	A	7: 127,592,662	L356Q	probably damaging	Het
Sin3b	G	T	8: 72,723,511	G19W	unknown	Het
Slc6a15	A	G	10: 103,404,315	R300G	probably damaging	Het
Sncaip	A	T	18: 52,894,838	K433M	probably damaging	Het
Tead2	A	T	7: 45,232,892		probably benign	Het
Tespa1	A	G	10: 130,348,239	D63G	probably benign	Het
Tmem117	T	C	15: 95,094,367	F303L	probably damaging	Het
Tmem270	T	G	5: 134,901,796	T204P	probably damaging	Het
Trip12	A	G	1: 84,745,069	V1320A	probably damaging	Het
Ttc7b	A	G	12: 100,301,553	L843P	probably damaging	Het
Ttn	T	C	2: 76,712,697	Y33315C	probably damaging	Het
Ttn	A	G	2: 76,776,802	V17959A	possibly damaging	Het
Vmn2r73	A	G	7: 85,871,887	V291A	probably damaging	Het
Ywhag	T	A	5: 135,911,144	T199S	probably benign	Het
Zfp810	T	C	9: 22,279,275	T77A	probably benign	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47271271	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47095693	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46856142	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46484049	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	46001178	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	46015439	frame shift	probably null
R9745:Cntnap2	UTSW	6	46234166	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47049327	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- ACAGGCTTCTCCTCACTGT -3'
(R):5'- TAACAGTAAAGCAACAGTAGAGTATG -3'

Sequencing Primer
(F):5'- TCCTGGCCTACACTAACTTCAATAG -3'
(R):5'- CAGTAGAGTATGAATTCTGTCCTCC -3'

Posted On

2021-04-30