Incidental Mutation 'R8719:Zfp810'
ID 670021
Institutional Source Beutler Lab
Gene Symbol Zfp810
Ensembl Gene ENSMUSG00000066829
Gene Name zinc finger protein 810
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R8719 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 22276748-22307648 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22279275 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 77 (T77A)
Ref Sequence ENSEMBL: ENSMUSP00000150816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086278] [ENSMUST00000215202]
AlphaFold Q99K45
Predicted Effect silent
Transcript: ENSMUST00000086278
SMART Domains Protein: ENSMUSP00000083459
Gene: ENSMUSG00000066829

DomainStartEndE-ValueType
KRAB 4 64 1.09e-33 SMART
ZnF_C2H2 126 148 2.44e2 SMART
ZnF_C2H2 182 204 3.07e-1 SMART
ZnF_C2H2 210 232 8.47e-4 SMART
ZnF_C2H2 238 260 6.78e-3 SMART
ZnF_C2H2 266 288 6.13e-1 SMART
ZnF_C2H2 294 316 5.06e-2 SMART
ZnF_C2H2 322 344 4.79e-3 SMART
ZnF_C2H2 350 372 2.99e-4 SMART
ZnF_C2H2 378 400 1.33e-1 SMART
ZnF_C2H2 406 428 2.75e-3 SMART
ZnF_C2H2 434 456 1.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215202
AA Change: T77A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T C 8: 46,513,663 I224T probably benign Het
Adamts20 C G 15: 94,344,022 A702P probably damaging Het
Ahdc1 T A 4: 133,064,222 Y925N possibly damaging Het
Anapc1 T C 2: 128,641,449 E1242G probably damaging Het
Angptl2 A G 2: 33,243,902 N412S possibly damaging Het
Aox3 T C 1: 58,119,537 V89A probably damaging Het
Atxn1l A T 8: 109,733,229 S134T possibly damaging Het
Brf1 C A 12: 112,979,684 probably benign Het
Cab39l A T 14: 59,496,865 H11L probably benign Het
Cabcoco1 A G 10: 68,436,841 probably benign Het
Ccdc150 C A 1: 54,263,509 P96Q probably benign Het
Chek2 T C 5: 110,867,042 V459A probably damaging Het
Cntnap2 A T 6: 46,001,227 D272V probably damaging Het
Cspp1 T C 1: 10,090,291 S572P possibly damaging Het
Cysltr2 T C 14: 73,029,671 T200A possibly damaging Het
Dglucy T C 12: 100,838,562 L104P probably damaging Het
Dnah8 T A 17: 30,741,315 M2222K probably damaging Het
Dync2h1 C A 9: 7,041,641 V3334F probably benign Het
Ear2 A T 14: 44,103,277 T131S possibly damaging Het
Eef1akmt2 A T 7: 132,850,611 V92D probably damaging Het
Fam83c T A 2: 155,829,208 Q769L probably benign Het
Fanca A T 8: 123,288,128 C812S probably benign Het
Gm21663 T G 5: 25,941,164 R50S probably damaging Het
Gm5591 T G 7: 38,522,190 S152R probably benign Het
Gm6370 T G 5: 146,493,816 D270E probably damaging Het
H2-T22 T C 17: 36,041,943 I91V probably benign Het
Hdac5 T C 11: 102,207,137 M61V probably benign Het
Hsd17b6 A G 10: 127,993,623 S237P possibly damaging Het
Khk T A 5: 30,931,030 F294I possibly damaging Het
Klc1 G A 12: 111,806,075 probably benign Het
Lamb3 T C 1: 193,323,791 W143R probably damaging Het
Lmo2 T C 2: 103,980,919 I171T probably damaging Het
Meis1 A G 11: 18,885,587 S344P probably benign Het
Nf1 C A 11: 79,390,293 R125S possibly damaging Het
Nrcam A G 12: 44,539,542 E105G probably benign Het
Nudt22 T C 19: 6,995,270 D150G possibly damaging Het
Olfr1434 A G 19: 12,283,428 I127V probably benign Het
Olfr1463 A G 19: 13,234,472 Y74C probably damaging Het
Olfr761 T C 17: 37,953,004 T7A probably damaging Het
Pclo A T 5: 14,713,764 R799* probably null Het
Pelp1 T C 11: 70,401,963 N175S probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pik3r4 C A 9: 105,682,195 S1162R probably benign Het
Pkd1l3 A T 8: 109,614,623 N36I unknown Het
Pomk T A 8: 25,983,475 Y150F possibly damaging Het
Rdh11 T A 12: 79,182,800 H233L probably benign Het
Rln1 A T 19: 29,331,881 M166K probably benign Het
Rnf40 T A 7: 127,592,662 L356Q probably damaging Het
Sin3b G T 8: 72,723,511 G19W unknown Het
Slc6a15 A G 10: 103,404,315 R300G probably damaging Het
Sncaip A T 18: 52,894,838 K433M probably damaging Het
Tead2 A T 7: 45,232,892 probably benign Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Tmem117 T C 15: 95,094,367 F303L probably damaging Het
Tmem270 T G 5: 134,901,796 T204P probably damaging Het
Trip12 A G 1: 84,745,069 V1320A probably damaging Het
Ttc7b A G 12: 100,301,553 L843P probably damaging Het
Ttn T C 2: 76,712,697 Y33315C probably damaging Het
Ttn A G 2: 76,776,802 V17959A possibly damaging Het
Vmn2r73 A G 7: 85,871,887 V291A probably damaging Het
Ywhag T A 5: 135,911,144 T199S probably benign Het
Other mutations in Zfp810
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Zfp810 APN 9 22278309 nonsense probably null
IGL03079:Zfp810 APN 9 22284127 missense probably damaging 1.00
IGL03402:Zfp810 APN 9 22279145 splice site probably null
H8562:Zfp810 UTSW 9 22279091 missense probably benign 0.42
R1116:Zfp810 UTSW 9 22279085 missense probably benign 0.11
R1160:Zfp810 UTSW 9 22278532 missense possibly damaging 0.64
R1171:Zfp810 UTSW 9 22278826 missense possibly damaging 0.95
R1393:Zfp810 UTSW 9 22280514 missense probably benign
R1608:Zfp810 UTSW 9 22278920 missense probably benign 0.00
R1644:Zfp810 UTSW 9 22279028 missense possibly damaging 0.67
R1766:Zfp810 UTSW 9 22278532 missense possibly damaging 0.64
R2568:Zfp810 UTSW 9 22279238 missense probably benign 0.01
R3684:Zfp810 UTSW 9 22278235 missense probably benign 0.01
R4002:Zfp810 UTSW 9 22278892 missense probably damaging 1.00
R4134:Zfp810 UTSW 9 22279073 missense probably damaging 0.97
R4135:Zfp810 UTSW 9 22279073 missense probably damaging 0.97
R4334:Zfp810 UTSW 9 22278784 missense probably benign 0.00
R4545:Zfp810 UTSW 9 22278745 missense probably damaging 0.96
R5399:Zfp810 UTSW 9 22278829 missense possibly damaging 0.91
R5622:Zfp810 UTSW 9 22279096 missense probably benign 0.00
R5643:Zfp810 UTSW 9 22283171 missense probably benign 0.26
R7375:Zfp810 UTSW 9 22290537 critical splice donor site probably null
R7441:Zfp810 UTSW 9 22279272 nonsense probably null
R7809:Zfp810 UTSW 9 22278982 missense possibly damaging 0.51
R8422:Zfp810 UTSW 9 22283222 nonsense probably null
R8526:Zfp810 UTSW 9 22278290 missense probably damaging 1.00
R9177:Zfp810 UTSW 9 22278640 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTGATACTGACTGAGGGTAG -3'
(R):5'- TGCAGATCAGGAAGCAGAGTTC -3'

Sequencing Primer
(F):5'- CTGATACTGACTGAGGGTAGACTTAG -3'
(R):5'- TCAGGAAGCAGAGTTCCTAATAC -3'
Posted On 2021-04-30