Incidental Mutation 'R8719:Olfr1434'
ID 670047
Institutional Source Beutler Lab
Gene Symbol Olfr1434
Ensembl Gene ENSMUSG00000095640
Gene Name olfactory receptor 1434
Synonyms MOR214-4, Olfr1433, MOR214-4, GA_x6K02T2RE5P-2618516-2619454, GA_x6K02T2RE5P-2610001-2610414
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock # R8719 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 12279854-12285626 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12283428 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 127 (I127V)
Ref Sequence ENSEMBL: ENSMUSP00000146925 (fasta)
AlphaFold Q7TQR9
Predicted Effect probably benign
Transcript: ENSMUST00000207186
AA Change: I127V

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect silent
Transcript: ENSMUST00000207915
Predicted Effect probably benign
Transcript: ENSMUST00000208197
AA Change: I127V

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T C 8: 46,513,663 I224T probably benign Het
Adamts20 C G 15: 94,344,022 A702P probably damaging Het
Ahdc1 T A 4: 133,064,222 Y925N possibly damaging Het
Anapc1 T C 2: 128,641,449 E1242G probably damaging Het
Angptl2 A G 2: 33,243,902 N412S possibly damaging Het
Aox3 T C 1: 58,119,537 V89A probably damaging Het
Atxn1l A T 8: 109,733,229 S134T possibly damaging Het
Brf1 C A 12: 112,979,684 probably benign Het
Cab39l A T 14: 59,496,865 H11L probably benign Het
Cabcoco1 A G 10: 68,436,841 probably benign Het
Ccdc150 C A 1: 54,263,509 P96Q probably benign Het
Chek2 T C 5: 110,867,042 V459A probably damaging Het
Cntnap2 A T 6: 46,001,227 D272V probably damaging Het
Cspp1 T C 1: 10,090,291 S572P possibly damaging Het
Cysltr2 T C 14: 73,029,671 T200A possibly damaging Het
Dglucy T C 12: 100,838,562 L104P probably damaging Het
Dnah8 T A 17: 30,741,315 M2222K probably damaging Het
Dync2h1 C A 9: 7,041,641 V3334F probably benign Het
Ear2 A T 14: 44,103,277 T131S possibly damaging Het
Eef1akmt2 A T 7: 132,850,611 V92D probably damaging Het
Fam83c T A 2: 155,829,208 Q769L probably benign Het
Fanca A T 8: 123,288,128 C812S probably benign Het
Gm21663 T G 5: 25,941,164 R50S probably damaging Het
Gm5591 T G 7: 38,522,190 S152R probably benign Het
Gm6370 T G 5: 146,493,816 D270E probably damaging Het
H2-T22 T C 17: 36,041,943 I91V probably benign Het
Hdac5 T C 11: 102,207,137 M61V probably benign Het
Hsd17b6 A G 10: 127,993,623 S237P possibly damaging Het
Khk T A 5: 30,931,030 F294I possibly damaging Het
Klc1 G A 12: 111,806,075 probably benign Het
Lamb3 T C 1: 193,323,791 W143R probably damaging Het
Lmo2 T C 2: 103,980,919 I171T probably damaging Het
Meis1 A G 11: 18,885,587 S344P probably benign Het
Nf1 C A 11: 79,390,293 R125S possibly damaging Het
Nrcam A G 12: 44,539,542 E105G probably benign Het
Nudt22 T C 19: 6,995,270 D150G possibly damaging Het
Olfr1463 A G 19: 13,234,472 Y74C probably damaging Het
Olfr761 T C 17: 37,953,004 T7A probably damaging Het
Pclo A T 5: 14,713,764 R799* probably null Het
Pelp1 T C 11: 70,401,963 N175S probably damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pik3r4 C A 9: 105,682,195 S1162R probably benign Het
Pkd1l3 A T 8: 109,614,623 N36I unknown Het
Pomk T A 8: 25,983,475 Y150F possibly damaging Het
Rdh11 T A 12: 79,182,800 H233L probably benign Het
Rln1 A T 19: 29,331,881 M166K probably benign Het
Rnf40 T A 7: 127,592,662 L356Q probably damaging Het
Sin3b G T 8: 72,723,511 G19W unknown Het
Slc6a15 A G 10: 103,404,315 R300G probably damaging Het
Sncaip A T 18: 52,894,838 K433M probably damaging Het
Tead2 A T 7: 45,232,892 probably benign Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Tmem117 T C 15: 95,094,367 F303L probably damaging Het
Tmem270 T G 5: 134,901,796 T204P probably damaging Het
Trip12 A G 1: 84,745,069 V1320A probably damaging Het
Ttc7b A G 12: 100,301,553 L843P probably damaging Het
Ttn T C 2: 76,712,697 Y33315C probably damaging Het
Ttn A G 2: 76,776,802 V17959A possibly damaging Het
Vmn2r73 A G 7: 85,871,887 V291A probably damaging Het
Ywhag T A 5: 135,911,144 T199S probably benign Het
Zfp810 T C 9: 22,279,275 T77A probably benign Het
Other mutations in Olfr1434
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Olfr1434 APN 19 12283705 missense probably damaging 1.00
IGL02415:Olfr1434 APN 19 12283498 missense probably benign 0.44
IGL02731:Olfr1434 APN 19 12283842 missense probably damaging 0.99
IGL02803:Olfr1434 APN 19 12283983 missense possibly damaging 0.94
IGL03050:Olfr1434 UTSW 19 12283512 missense probably benign
R0432:Olfr1434 UTSW 19 12283903 missense probably damaging 1.00
R2209:Olfr1434 UTSW 19 12283860 missense probably benign 0.41
R3710:Olfr1434 UTSW 19 12283086 missense probably damaging 1.00
R4724:Olfr1434 UTSW 19 12283096 missense probably damaging 1.00
R5133:Olfr1434 UTSW 19 12283306 missense possibly damaging 0.96
R5974:Olfr1434 UTSW 19 12283836 missense probably damaging 1.00
R6544:Olfr1434 UTSW 19 12283155 missense probably damaging 1.00
R7225:Olfr1434 UTSW 19 12283467 missense probably benign 0.00
R7320:Olfr1434 UTSW 19 12283816 missense possibly damaging 0.72
R7467:Olfr1434 UTSW 19 12283475 nonsense probably null
R7900:Olfr1434 UTSW 19 12283341 missense probably damaging 1.00
R9135:Olfr1434 UTSW 19 12283444 missense probably damaging 1.00
R9324:Olfr1434 UTSW 19 12283575 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GGACTCCTATCTCCATACACCTATG -3'
(R):5'- TTAACAGCTGGGGCATGTC -3'

Sequencing Primer
(F):5'- TCCTCAGTAATCTGTCCTTTATAGAC -3'
(R):5'- TGTCACAGAAGAAATGTCTGATGAC -3'
Posted On 2021-04-30