Mutagenetix > Incidental Mutation

Incidental Mutation 'R8720:Ubr4'

670064

Institutional Source

Beutler Lab

Gene Symbol

Ubr4

Ensembl Gene

ENSMUSG00000066036

Gene Name

ubiquitin protein ligase E3 component n-recognin 4

Synonyms

p600, A930005E13Rik, LOC381562, D930005K06Rik, Zubr1, 1810009A16Rik

MMRRC Submission

068571-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8720 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

139107970-139216844 bp(+) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 139208149 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125800 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097822] [ENSMUST00000165860]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000097822

SMART Domains

Protein: ENSMUSP00000095433
Gene: ENSMUSG00000066036

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	414	425	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC
low complexity region	555	566	N/A	INTRINSIC
low complexity region	571	588	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1642	1655	N/A	INTRINSIC
Pfam:zf-UBR	1660	1725	1.9e-9	PFAM
Blast:ZnF_C2H2	1966	1991	6e-8	BLAST
low complexity region	2268	2279	N/A	INTRINSIC
low complexity region	2502	2540	N/A	INTRINSIC
low complexity region	2725	2735	N/A	INTRINSIC
low complexity region	2818	2852	N/A	INTRINSIC
low complexity region	2887	2905	N/A	INTRINSIC
low complexity region	2928	2942	N/A	INTRINSIC
low complexity region	2945	2959	N/A	INTRINSIC
low complexity region	2966	2986	N/A	INTRINSIC
low complexity region	3063	3091	N/A	INTRINSIC
low complexity region	3329	3385	N/A	INTRINSIC
low complexity region	3776	3788	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	4364	5160	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135534

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141327

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145273

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145659

Predicted Effect

probably null
Transcript: ENSMUST00000165860

SMART Domains

Protein: ENSMUSP00000125800
Gene: ENSMUSG00000066036

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	414	425	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC
low complexity region	555	566	N/A	INTRINSIC
low complexity region	571	588	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1642	1655	N/A	INTRINSIC
Pfam:zf-UBR	1659	1729	4e-13	PFAM
Blast:ZnF_C2H2	1966	1991	5e-8	BLAST
low complexity region	2268	2279	N/A	INTRINSIC
low complexity region	2513	2551	N/A	INTRINSIC
low complexity region	2736	2746	N/A	INTRINSIC
low complexity region	2863	2881	N/A	INTRINSIC
low complexity region	2904	2918	N/A	INTRINSIC
low complexity region	2921	2935	N/A	INTRINSIC
low complexity region	2942	2962	N/A	INTRINSIC
low complexity region	3039	3067	N/A	INTRINSIC
low complexity region	3305	3361	N/A	INTRINSIC
low complexity region	3752	3764	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	4340	5136	N/A	PFAM

Meta Mutation Damage Score

0.9590

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit neonatal lethality and decreased body size at birth. Mice homozygous for a null mutation display complete embryonic lethality during organogenesis with arrest of vitelline vascular remodeling. [provided by MGI curators]

Allele List at MGI

All alleles(59) : Targeted(2) Gene trapped(56) Transgenic(1)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh3a1	T	C	11: 61,104,305 (GRCm39)	V64A	probably benign	Het
Anln	T	C	9: 22,284,573 (GRCm39)	H379R	probably benign	Het
Asb2	A	G	12: 103,291,680 (GRCm39)	Y416H	probably damaging	Het
Atp2b4	TTCTTC	TTCTTCGTCTTC	1: 133,629,465 (GRCm39)		probably benign	Het
Chsy1	T	A	7: 65,821,088 (GRCm39)	M441K	possibly damaging	Het
Cmas	A	G	6: 142,716,929 (GRCm39)	K274E	probably damaging	Het
Cmip	A	G	8: 118,138,010 (GRCm39)	Y75C	probably damaging	Het
Col17a1	T	A	19: 47,637,531 (GRCm39)		probably benign	Het
Col3a1	A	G	1: 45,386,893 (GRCm39)	Y1368C	unknown	Het
Cracdl	A	G	1: 37,652,522 (GRCm39)	F1095S	possibly damaging	Het
Cspg4	C	T	9: 56,794,797 (GRCm39)	T844I	probably benign	Het
Dnai7	G	T	6: 145,150,983 (GRCm39)	R30S	unknown	Het
Ect2	A	T	3: 27,169,647 (GRCm39)	N766K	probably damaging	Het
Fanci	C	A	7: 79,089,425 (GRCm39)	Q954K	possibly damaging	Het
Gm30083	A	G	14: 33,736,895 (GRCm39)	S21P	probably benign	Het
Gulo	C	T	14: 66,225,074 (GRCm39)	E422K	probably benign	Het
Helq	A	G	5: 100,914,561 (GRCm39)	V977A	probably damaging	Het
Herc1	A	G	9: 66,389,105 (GRCm39)	D3874G	probably benign	Het
Hsf4	G	T	8: 105,996,605 (GRCm39)	D34Y	probably damaging	Het
Il18	G	A	9: 50,476,684 (GRCm39)		probably benign	Het
Il22ra2	A	T	10: 19,508,599 (GRCm39)	E209V	probably damaging	Het
Ino80	A	T	2: 119,232,868 (GRCm39)	L1150Q	probably damaging	Het
Kif16b	A	G	2: 142,691,792 (GRCm39)	F231L	probably damaging	Het
Krtap19-4	A	G	16: 88,681,846 (GRCm39)	Y37H	unknown	Het
Lama4	A	T	10: 38,971,079 (GRCm39)	D1548V	probably damaging	Het
Lrig2	C	T	3: 104,418,998 (GRCm39)	A4T	probably damaging	Het
Lrp4	A	T	2: 91,324,459 (GRCm39)	I1265F	probably damaging	Het
Muc16	T	A	9: 18,552,896 (GRCm39)	T4466S	probably benign	Het
Myo1e	A	G	9: 70,204,570 (GRCm39)	I57V	possibly damaging	Het
Naip2	A	T	13: 100,298,630 (GRCm39)	Y469N	probably benign	Het
Nav1	G	A	1: 135,388,464 (GRCm39)	R1065C	unknown	Het
Nps	C	T	7: 134,874,045 (GRCm39)	R72C	probably damaging	Het
Nup210l	G	A	3: 90,117,681 (GRCm39)	V1796I	probably benign	Het
Pdzd7	T	C	19: 45,024,667 (GRCm39)	K451E	probably benign	Het
Pigv	A	T	4: 133,392,968 (GRCm39)	D67E	probably damaging	Het
Pik3cg	A	T	12: 32,243,688 (GRCm39)	F928I	probably benign	Het
Pkn3	A	G	2: 29,975,196 (GRCm39)	N486D	probably benign	Het
Ppp2r3d	A	G	9: 101,089,084 (GRCm39)	L413P	probably damaging	Het
Rbm45	G	T	2: 76,210,711 (GRCm39)	R414L	probably damaging	Het
Sap30l	A	T	11: 57,698,875 (GRCm39)	N116I	probably damaging	Het
Slc17a5	A	T	9: 78,485,945 (GRCm39)	F47I	probably damaging	Het
Slco1a7	A	T	6: 141,668,852 (GRCm39)	S527T	probably benign	Het
Srbd1	A	T	17: 86,358,571 (GRCm39)	D659E	probably damaging	Het
Sycp3	A	G	10: 88,298,394 (GRCm39)	Q40R	probably benign	Het
Trip13	T	C	13: 74,063,590 (GRCm39)	S374G	probably benign	Het
Ush2a	G	A	1: 188,090,715 (GRCm39)	V449I	probably benign	Het
Vmn1r211	A	T	13: 23,036,031 (GRCm39)	V212D	probably damaging	Het
Vmn2r111	T	A	17: 22,792,194 (GRCm39)	I21F	possibly damaging	Het
Zmiz2	A	T	11: 6,349,904 (GRCm39)	I491F	possibly damaging	Het

Other mutations in Ubr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ubr4	APN	4	139,192,633 (GRCm39)	missense	possibly damaging	0.46
IGL00336:Ubr4	APN	4	139,155,877 (GRCm39)	missense	probably damaging	1.00
IGL00586:Ubr4	APN	4	139,182,495 (GRCm39)	missense	possibly damaging	0.95
IGL00659:Ubr4	APN	4	139,148,556 (GRCm39)	missense	probably damaging	1.00
IGL00766:Ubr4	APN	4	139,168,077 (GRCm39)	missense	probably damaging	1.00
IGL00819:Ubr4	APN	4	139,203,593 (GRCm39)	missense	possibly damaging	0.92
IGL00833:Ubr4	APN	4	139,120,470 (GRCm39)	critical splice donor site	probably null
IGL01126:Ubr4	APN	4	139,129,866 (GRCm39)	missense	probably benign	0.04
IGL01311:Ubr4	APN	4	139,206,356 (GRCm39)	missense	possibly damaging	0.66
IGL01349:Ubr4	APN	4	139,208,039 (GRCm39)	missense	unknown
IGL01388:Ubr4	APN	4	139,187,554 (GRCm39)	missense	possibly damaging	0.76
IGL01417:Ubr4	APN	4	139,138,111 (GRCm39)	missense	probably damaging	0.99
IGL01446:Ubr4	APN	4	139,165,351 (GRCm39)	splice site	probably benign
IGL01449:Ubr4	APN	4	139,140,047 (GRCm39)	missense	probably damaging	0.98
IGL01545:Ubr4	APN	4	139,170,140 (GRCm39)	splice site	probably benign
IGL01568:Ubr4	APN	4	139,148,684 (GRCm39)	missense	probably damaging	1.00
IGL01596:Ubr4	APN	4	139,189,845 (GRCm39)	splice site	probably benign
IGL01621:Ubr4	APN	4	139,168,094 (GRCm39)	nonsense	probably null
IGL01639:Ubr4	APN	4	139,144,655 (GRCm39)	missense	probably damaging	0.99
IGL01655:Ubr4	APN	4	139,135,107 (GRCm39)	missense	probably damaging	1.00
IGL01710:Ubr4	APN	4	139,145,772 (GRCm39)	missense	possibly damaging	0.81
IGL01830:Ubr4	APN	4	139,199,811 (GRCm39)	missense	probably damaging	0.99
IGL01862:Ubr4	APN	4	139,204,469 (GRCm39)	missense	possibly damaging	0.66
IGL01868:Ubr4	APN	4	139,139,989 (GRCm39)	nonsense	probably null
IGL01874:Ubr4	APN	4	139,120,600 (GRCm39)	splice site	probably benign
IGL01889:Ubr4	APN	4	139,189,783 (GRCm39)	nonsense	probably null
IGL01891:Ubr4	APN	4	139,163,571 (GRCm39)	critical splice donor site	probably null
IGL01980:Ubr4	APN	4	139,156,913 (GRCm39)	missense	probably damaging	0.99
IGL02126:Ubr4	APN	4	139,180,052 (GRCm39)	critical splice donor site	probably null
IGL02153:Ubr4	APN	4	139,187,471 (GRCm39)	nonsense	probably null
IGL02173:Ubr4	APN	4	139,164,381 (GRCm39)	splice site	probably null
IGL02214:Ubr4	APN	4	139,155,894 (GRCm39)	missense	possibly damaging	0.95
IGL02214:Ubr4	APN	4	139,189,138 (GRCm39)	critical splice acceptor site	probably null
IGL02220:Ubr4	APN	4	139,115,746 (GRCm39)	missense	probably benign	0.01
IGL02246:Ubr4	APN	4	139,186,414 (GRCm39)	missense	possibly damaging	0.89
IGL02264:Ubr4	APN	4	139,182,939 (GRCm39)	nonsense	probably null
IGL02273:Ubr4	APN	4	139,199,889 (GRCm39)	missense	possibly damaging	0.94
IGL02316:Ubr4	APN	4	139,200,489 (GRCm39)	missense	possibly damaging	0.46
IGL02328:Ubr4	APN	4	139,206,233 (GRCm39)	missense	probably damaging	0.97
IGL02476:Ubr4	APN	4	139,148,560 (GRCm39)	nonsense	probably null
IGL02477:Ubr4	APN	4	139,163,516 (GRCm39)	missense	probably damaging	0.98
IGL02544:Ubr4	APN	4	139,142,429 (GRCm39)	missense	probably damaging	1.00
IGL02622:Ubr4	APN	4	139,194,561 (GRCm39)	nonsense	probably null
IGL02679:Ubr4	APN	4	139,186,445 (GRCm39)	missense	probably damaging	0.99
IGL02728:Ubr4	APN	4	139,196,122 (GRCm39)	missense	probably damaging	1.00
IGL02754:Ubr4	APN	4	139,138,095 (GRCm39)	missense	probably damaging	0.99
IGL02754:Ubr4	APN	4	139,120,470 (GRCm39)	critical splice donor site	probably null
IGL02892:Ubr4	APN	4	139,144,642 (GRCm39)	missense	probably damaging	0.96
IGL02897:Ubr4	APN	4	139,199,819 (GRCm39)	missense	probably damaging	0.97
IGL02946:Ubr4	APN	4	139,152,606 (GRCm39)	missense	probably damaging	1.00
IGL02964:Ubr4	APN	4	139,135,131 (GRCm39)	missense	possibly damaging	0.84
IGL03059:Ubr4	APN	4	139,207,987 (GRCm39)	missense	probably damaging	0.98
IGL03068:Ubr4	APN	4	139,137,041 (GRCm39)	missense	probably benign	0.02
IGL03087:Ubr4	APN	4	139,177,668 (GRCm39)	nonsense	probably null
IGL03116:Ubr4	APN	4	139,206,892 (GRCm39)	splice site	probably benign
IGL03212:Ubr4	APN	4	139,137,074 (GRCm39)	missense	probably benign	0.13
IGL03228:Ubr4	APN	4	139,156,909 (GRCm39)	missense	probably damaging	1.00
IGL03292:Ubr4	APN	4	139,167,746 (GRCm39)	missense	probably damaging	1.00
IGL03388:Ubr4	APN	4	139,142,343 (GRCm39)	missense	probably damaging	0.98
IGL03393:Ubr4	APN	4	139,179,989 (GRCm39)	missense	probably damaging	1.00
IGL03409:Ubr4	APN	4	139,127,240 (GRCm39)	nonsense	probably null
Aqua_regia	UTSW	4	139,180,030 (GRCm39)	nonsense	probably null
Eats	UTSW	4	139,190,886 (GRCm39)	missense	probably damaging	0.97
Hardened	UTSW	4	139,196,158 (GRCm39)	missense	probably damaging	1.00
Stoney	UTSW	4	139,171,998 (GRCm39)	missense	probably damaging	1.00
Uber	UTSW	4	139,206,373 (GRCm39)	critical splice donor site	probably null
BB001:Ubr4	UTSW	4	139,194,587 (GRCm39)	missense	unknown
BB011:Ubr4	UTSW	4	139,194,587 (GRCm39)	missense	unknown
P0019:Ubr4	UTSW	4	139,179,092 (GRCm39)	missense	probably damaging	1.00
PIT4544001:Ubr4	UTSW	4	139,129,871 (GRCm39)	missense	possibly damaging	0.93
R0001:Ubr4	UTSW	4	139,179,099 (GRCm39)	missense	probably damaging	1.00
R0002:Ubr4	UTSW	4	139,118,211 (GRCm39)	missense	probably damaging	1.00
R0006:Ubr4	UTSW	4	139,158,960 (GRCm39)	missense	probably benign	0.03
R0006:Ubr4	UTSW	4	139,158,960 (GRCm39)	missense	probably benign	0.03
R0008:Ubr4	UTSW	4	139,157,487 (GRCm39)	missense	probably damaging	1.00
R0027:Ubr4	UTSW	4	139,127,704 (GRCm39)	missense	probably damaging	0.99
R0027:Ubr4	UTSW	4	139,127,704 (GRCm39)	missense	probably damaging	0.99
R0030:Ubr4	UTSW	4	139,154,104 (GRCm39)	missense	probably damaging	1.00
R0044:Ubr4	UTSW	4	139,164,369 (GRCm39)	splice site	probably benign
R0044:Ubr4	UTSW	4	139,164,369 (GRCm39)	splice site	probably benign
R0088:Ubr4	UTSW	4	139,168,125 (GRCm39)	missense	probably damaging	1.00
R0131:Ubr4	UTSW	4	139,191,362 (GRCm39)	missense	possibly damaging	0.66
R0184:Ubr4	UTSW	4	139,172,573 (GRCm39)	missense	probably damaging	1.00
R0219:Ubr4	UTSW	4	139,157,568 (GRCm39)	missense	possibly damaging	0.64
R0227:Ubr4	UTSW	4	139,158,960 (GRCm39)	missense	probably benign	0.03
R0270:Ubr4	UTSW	4	139,206,746 (GRCm39)	splice site	probably benign
R0285:Ubr4	UTSW	4	139,168,112 (GRCm39)	missense	probably damaging	1.00
R0322:Ubr4	UTSW	4	139,149,729 (GRCm39)	missense	probably damaging	1.00
R0363:Ubr4	UTSW	4	139,119,171 (GRCm39)	missense	probably damaging	0.98
R0393:Ubr4	UTSW	4	139,138,171 (GRCm39)	splice site	probably benign
R0450:Ubr4	UTSW	4	139,157,534 (GRCm39)	missense	probably benign	0.14
R0504:Ubr4	UTSW	4	139,133,889 (GRCm39)	missense	probably damaging	1.00
R0504:Ubr4	UTSW	4	139,208,149 (GRCm39)	critical splice donor site	probably null
R0510:Ubr4	UTSW	4	139,157,534 (GRCm39)	missense	probably benign	0.14
R0513:Ubr4	UTSW	4	139,144,186 (GRCm39)	missense	possibly damaging	0.74
R0517:Ubr4	UTSW	4	139,119,435 (GRCm39)	missense	probably benign	0.00
R0558:Ubr4	UTSW	4	139,154,213 (GRCm39)	missense	probably benign	0.09
R0617:Ubr4	UTSW	4	139,206,373 (GRCm39)	critical splice donor site	probably null
R0636:Ubr4	UTSW	4	139,163,613 (GRCm39)	splice site	probably null
R0637:Ubr4	UTSW	4	139,126,926 (GRCm39)	missense	probably damaging	1.00
R0652:Ubr4	UTSW	4	139,128,637 (GRCm39)	missense	probably damaging	0.99
R0691:Ubr4	UTSW	4	139,151,217 (GRCm39)	missense	probably damaging	1.00
R0729:Ubr4	UTSW	4	139,212,631 (GRCm39)	missense	possibly damaging	0.66
R0735:Ubr4	UTSW	4	139,155,339 (GRCm39)	splice site	probably null
R0751:Ubr4	UTSW	4	139,164,509 (GRCm39)	splice site	probably benign
R0789:Ubr4	UTSW	4	139,137,582 (GRCm39)	critical splice donor site	probably null
R0825:Ubr4	UTSW	4	139,206,887 (GRCm39)	critical splice donor site	probably null
R0828:Ubr4	UTSW	4	139,177,864 (GRCm39)	splice site	probably benign
R1052:Ubr4	UTSW	4	139,182,771 (GRCm39)	missense	possibly damaging	0.83
R1184:Ubr4	UTSW	4	139,164,509 (GRCm39)	splice site	probably benign
R1222:Ubr4	UTSW	4	139,115,782 (GRCm39)	splice site	probably null
R1258:Ubr4	UTSW	4	139,154,225 (GRCm39)	missense	probably damaging	1.00
R1321:Ubr4	UTSW	4	139,187,434 (GRCm39)	missense	possibly damaging	0.46
R1385:Ubr4	UTSW	4	139,129,923 (GRCm39)	missense	probably benign	0.00
R1450:Ubr4	UTSW	4	139,195,339 (GRCm39)	missense	probably damaging	1.00
R1470:Ubr4	UTSW	4	139,148,537 (GRCm39)	splice site	probably null
R1470:Ubr4	UTSW	4	139,148,537 (GRCm39)	splice site	probably null
R1474:Ubr4	UTSW	4	139,156,890 (GRCm39)	missense	probably damaging	1.00
R1479:Ubr4	UTSW	4	139,153,151 (GRCm39)	missense	possibly damaging	0.95
R1534:Ubr4	UTSW	4	139,155,462 (GRCm39)	missense	possibly damaging	0.95
R1546:Ubr4	UTSW	4	139,144,238 (GRCm39)	nonsense	probably null
R1785:Ubr4	UTSW	4	139,151,256 (GRCm39)	missense	probably damaging	1.00
R1786:Ubr4	UTSW	4	139,151,256 (GRCm39)	missense	probably damaging	1.00
R1789:Ubr4	UTSW	4	139,120,364 (GRCm39)	missense	probably damaging	1.00
R1796:Ubr4	UTSW	4	139,155,907 (GRCm39)	missense	probably benign	0.25
R1800:Ubr4	UTSW	4	139,135,274 (GRCm39)	missense	probably damaging	0.99
R1801:Ubr4	UTSW	4	139,179,874 (GRCm39)	splice site	probably null
R1827:Ubr4	UTSW	4	139,153,008 (GRCm39)	critical splice acceptor site	probably null
R1887:Ubr4	UTSW	4	139,182,871 (GRCm39)	missense	probably damaging	1.00
R1966:Ubr4	UTSW	4	139,178,555 (GRCm39)	critical splice acceptor site	probably null
R2010:Ubr4	UTSW	4	139,207,963 (GRCm39)	missense	possibly damaging	0.92
R2049:Ubr4	UTSW	4	139,204,518 (GRCm39)	missense	probably damaging	0.97
R2069:Ubr4	UTSW	4	139,206,851 (GRCm39)	missense	possibly damaging	0.66
R2114:Ubr4	UTSW	4	139,156,922 (GRCm39)	nonsense	probably null
R2140:Ubr4	UTSW	4	139,204,518 (GRCm39)	missense	probably damaging	0.97
R2141:Ubr4	UTSW	4	139,204,518 (GRCm39)	missense	probably damaging	0.97
R2142:Ubr4	UTSW	4	139,204,518 (GRCm39)	missense	probably damaging	0.97
R2168:Ubr4	UTSW	4	139,137,960 (GRCm39)	missense	probably benign	0.25
R2237:Ubr4	UTSW	4	139,170,101 (GRCm39)	missense	probably damaging	1.00
R2249:Ubr4	UTSW	4	139,176,232 (GRCm39)	missense	probably damaging	1.00
R2261:Ubr4	UTSW	4	139,140,773 (GRCm39)	missense	probably damaging	0.99
R2264:Ubr4	UTSW	4	139,147,684 (GRCm39)	splice site	probably benign
R2353:Ubr4	UTSW	4	139,160,984 (GRCm39)	missense	possibly damaging	0.48
R2437:Ubr4	UTSW	4	139,200,853 (GRCm39)	missense	possibly damaging	0.90
R2496:Ubr4	UTSW	4	139,200,516 (GRCm39)	unclassified	probably benign
R2896:Ubr4	UTSW	4	139,182,955 (GRCm39)	splice site	probably null
R2922:Ubr4	UTSW	4	139,206,811 (GRCm39)	missense	possibly damaging	0.66
R2972:Ubr4	UTSW	4	139,133,847 (GRCm39)	missense	probably benign	0.22
R2973:Ubr4	UTSW	4	139,133,847 (GRCm39)	missense	probably benign	0.22
R2989:Ubr4	UTSW	4	139,190,869 (GRCm39)	missense	possibly damaging	0.89
R3176:Ubr4	UTSW	4	139,149,166 (GRCm39)	missense	probably benign	0.03
R3276:Ubr4	UTSW	4	139,149,166 (GRCm39)	missense	probably benign	0.03
R3772:Ubr4	UTSW	4	139,180,011 (GRCm39)	missense	possibly damaging	0.89
R3844:Ubr4	UTSW	4	139,186,437 (GRCm39)	missense	probably damaging	0.99
R3873:Ubr4	UTSW	4	139,151,301 (GRCm39)	missense	probably damaging	1.00
R3900:Ubr4	UTSW	4	139,206,373 (GRCm39)	critical splice donor site	probably null
R3951:Ubr4	UTSW	4	139,120,405 (GRCm39)	missense	probably damaging	1.00
R4020:Ubr4	UTSW	4	139,179,116 (GRCm39)	missense	probably damaging	0.98
R4178:Ubr4	UTSW	4	139,120,725 (GRCm39)	missense	probably damaging	1.00
R4308:Ubr4	UTSW	4	139,199,820 (GRCm39)	missense	possibly damaging	0.46
R4378:Ubr4	UTSW	4	139,137,751 (GRCm39)	missense	possibly damaging	0.76
R4400:Ubr4	UTSW	4	139,189,167 (GRCm39)	missense	possibly damaging	0.66
R4421:Ubr4	UTSW	4	139,189,167 (GRCm39)	missense	possibly damaging	0.66
R4462:Ubr4	UTSW	4	139,145,813 (GRCm39)	missense	possibly damaging	0.47
R4583:Ubr4	UTSW	4	139,108,164 (GRCm39)	missense	possibly damaging	0.82
R4611:Ubr4	UTSW	4	139,126,890 (GRCm39)	missense	possibly damaging	0.93
R4664:Ubr4	UTSW	4	139,133,829 (GRCm39)	missense	possibly damaging	0.56
R4671:Ubr4	UTSW	4	139,163,502 (GRCm39)	missense	possibly damaging	0.66
R4672:Ubr4	UTSW	4	139,138,027 (GRCm39)	missense	probably damaging	0.99
R4673:Ubr4	UTSW	4	139,138,027 (GRCm39)	missense	probably damaging	0.99
R4696:Ubr4	UTSW	4	139,135,983 (GRCm39)	missense	probably benign	0.09
R4701:Ubr4	UTSW	4	139,198,647 (GRCm39)	missense	possibly damaging	0.66
R4705:Ubr4	UTSW	4	139,177,840 (GRCm39)	missense	probably damaging	1.00
R4726:Ubr4	UTSW	4	139,209,890 (GRCm39)	missense	possibly damaging	0.46
R4728:Ubr4	UTSW	4	139,151,190 (GRCm39)	missense	probably damaging	1.00
R4783:Ubr4	UTSW	4	139,149,044 (GRCm39)	missense	possibly damaging	0.85
R4833:Ubr4	UTSW	4	139,129,857 (GRCm39)	missense	probably damaging	0.98
R4892:Ubr4	UTSW	4	139,155,828 (GRCm39)	missense	probably benign	0.14
R4936:Ubr4	UTSW	4	139,123,877 (GRCm39)	missense	probably damaging	0.98
R5000:Ubr4	UTSW	4	139,163,480 (GRCm39)	missense	probably damaging	0.98
R5114:Ubr4	UTSW	4	139,137,934 (GRCm39)	missense	probably damaging	0.99
R5189:Ubr4	UTSW	4	139,137,960 (GRCm39)	missense	probably benign	0.25
R5197:Ubr4	UTSW	4	139,195,408 (GRCm39)	missense	probably damaging	1.00
R5213:Ubr4	UTSW	4	139,129,877 (GRCm39)	nonsense	probably null
R5219:Ubr4	UTSW	4	139,204,543 (GRCm39)	nonsense	probably null
R5346:Ubr4	UTSW	4	139,155,802 (GRCm39)	missense	probably damaging	0.97
R5368:Ubr4	UTSW	4	139,124,839 (GRCm39)	intron	probably benign
R5442:Ubr4	UTSW	4	139,135,083 (GRCm39)	missense	probably damaging	1.00
R5527:Ubr4	UTSW	4	139,208,099 (GRCm39)	missense	possibly damaging	0.83
R5548:Ubr4	UTSW	4	139,187,401 (GRCm39)	missense	probably damaging	0.97
R5568:Ubr4	UTSW	4	139,119,349 (GRCm39)	missense	probably damaging	0.99
R5639:Ubr4	UTSW	4	139,179,959 (GRCm39)	missense	possibly damaging	0.66
R5643:Ubr4	UTSW	4	139,171,998 (GRCm39)	missense	probably damaging	1.00
R5663:Ubr4	UTSW	4	139,155,894 (GRCm39)	missense	possibly damaging	0.95
R5755:Ubr4	UTSW	4	139,187,406 (GRCm39)	missense	possibly damaging	0.66
R5781:Ubr4	UTSW	4	139,195,407 (GRCm39)	missense	probably damaging	1.00
R5784:Ubr4	UTSW	4	139,152,529 (GRCm39)	missense	probably damaging	1.00
R5817:Ubr4	UTSW	4	139,196,158 (GRCm39)	missense	probably damaging	1.00
R5872:Ubr4	UTSW	4	139,152,641 (GRCm39)	missense	probably damaging	0.98
R5891:Ubr4	UTSW	4	139,135,937 (GRCm39)	nonsense	probably null
R5901:Ubr4	UTSW	4	139,178,565 (GRCm39)	missense	probably damaging	1.00
R5958:Ubr4	UTSW	4	139,182,949 (GRCm39)	missense	probably damaging	1.00
R5974:Ubr4	UTSW	4	139,148,389 (GRCm39)	splice site	probably null
R6065:Ubr4	UTSW	4	139,148,549 (GRCm39)	missense	probably damaging	1.00
R6109:Ubr4	UTSW	4	139,144,675 (GRCm39)	missense	probably damaging	0.99
R6207:Ubr4	UTSW	4	139,148,559 (GRCm39)	missense	probably damaging	1.00
R6265:Ubr4	UTSW	4	139,179,951 (GRCm39)	missense	possibly damaging	0.90
R6319:Ubr4	UTSW	4	139,136,200 (GRCm39)	missense	possibly damaging	0.84
R6342:Ubr4	UTSW	4	139,156,850 (GRCm39)	missense	possibly damaging	0.88
R6434:Ubr4	UTSW	4	139,156,949 (GRCm39)	missense	probably damaging	1.00
R6437:Ubr4	UTSW	4	139,124,525 (GRCm39)	critical splice donor site	probably null
R6481:Ubr4	UTSW	4	139,159,062 (GRCm39)	missense	probably damaging	0.97
R6502:Ubr4	UTSW	4	139,171,982 (GRCm39)	missense	probably damaging	1.00
R6546:Ubr4	UTSW	4	139,141,705 (GRCm39)	missense	probably damaging	0.99
R6603:Ubr4	UTSW	4	139,182,897 (GRCm39)	missense	probably benign	0.17
R6648:Ubr4	UTSW	4	139,180,030 (GRCm39)	nonsense	probably null
R6649:Ubr4	UTSW	4	139,200,935 (GRCm39)	missense	possibly damaging	0.66
R6653:Ubr4	UTSW	4	139,200,935 (GRCm39)	missense	possibly damaging	0.66
R6668:Ubr4	UTSW	4	139,192,652 (GRCm39)	missense	probably damaging	1.00
R6770:Ubr4	UTSW	4	139,216,493 (GRCm39)	missense	unknown
R6772:Ubr4	UTSW	4	139,194,541 (GRCm39)	nonsense	probably null
R6857:Ubr4	UTSW	4	139,213,362 (GRCm39)	missense	possibly damaging	0.90
R6869:Ubr4	UTSW	4	139,194,538 (GRCm39)	missense	possibly damaging	0.93
R6912:Ubr4	UTSW	4	139,185,545 (GRCm39)	critical splice donor site	probably null
R6943:Ubr4	UTSW	4	139,164,442 (GRCm39)	nonsense	probably null
R6970:Ubr4	UTSW	4	139,133,839 (GRCm39)	nonsense	probably null
R6976:Ubr4	UTSW	4	139,120,388 (GRCm39)	missense	probably damaging	0.98
R7000:Ubr4	UTSW	4	139,141,715 (GRCm39)	missense	probably damaging	1.00
R7017:Ubr4	UTSW	4	139,120,401 (GRCm39)	missense	probably damaging	0.99
R7165:Ubr4	UTSW	4	139,177,824 (GRCm39)	missense
R7222:Ubr4	UTSW	4	139,190,684 (GRCm39)	missense	unknown
R7241:Ubr4	UTSW	4	139,170,725 (GRCm39)	missense	probably damaging	1.00
R7343:Ubr4	UTSW	4	139,140,749 (GRCm39)	missense	probably benign	0.09
R7367:Ubr4	UTSW	4	139,180,002 (GRCm39)	missense	unknown
R7393:Ubr4	UTSW	4	139,154,096 (GRCm39)	missense	probably damaging	1.00
R7432:Ubr4	UTSW	4	139,115,693 (GRCm39)	missense	probably damaging	1.00
R7448:Ubr4	UTSW	4	139,189,778 (GRCm39)	missense	unknown
R7502:Ubr4	UTSW	4	139,139,983 (GRCm39)	missense	possibly damaging	0.72
R7514:Ubr4	UTSW	4	139,179,966 (GRCm39)	missense	unknown
R7526:Ubr4	UTSW	4	139,149,728 (GRCm39)	missense	probably benign	0.00
R7529:Ubr4	UTSW	4	139,149,728 (GRCm39)	missense	probably benign	0.00
R7666:Ubr4	UTSW	4	139,140,791 (GRCm39)	missense	possibly damaging	0.81
R7699:Ubr4	UTSW	4	139,136,178 (GRCm39)	nonsense	probably null
R7700:Ubr4	UTSW	4	139,136,178 (GRCm39)	nonsense	probably null
R7726:Ubr4	UTSW	4	139,186,231 (GRCm39)	missense	unknown
R7753:Ubr4	UTSW	4	139,197,603 (GRCm39)	missense	unknown
R7810:Ubr4	UTSW	4	139,142,394 (GRCm39)	missense
R7837:Ubr4	UTSW	4	139,120,462 (GRCm39)	nonsense	probably null
R7868:Ubr4	UTSW	4	139,187,344 (GRCm39)	missense	unknown
R7872:Ubr4	UTSW	4	139,120,373 (GRCm39)	missense	possibly damaging	0.94
R7887:Ubr4	UTSW	4	139,135,121 (GRCm39)	missense	probably damaging	0.99
R7924:Ubr4	UTSW	4	139,194,587 (GRCm39)	missense	unknown
R7980:Ubr4	UTSW	4	139,145,717 (GRCm39)	missense
R7982:Ubr4	UTSW	4	139,155,519 (GRCm39)	critical splice donor site	probably null
R8005:Ubr4	UTSW	4	139,139,941 (GRCm39)	missense	probably damaging	0.98
R8054:Ubr4	UTSW	4	139,195,413 (GRCm39)	missense	unknown
R8094:Ubr4	UTSW	4	139,168,007 (GRCm39)	missense	probably damaging	0.97
R8151:Ubr4	UTSW	4	139,130,112 (GRCm39)	missense	probably damaging	0.97
R8183:Ubr4	UTSW	4	139,209,782 (GRCm39)	missense	unknown
R8252:Ubr4	UTSW	4	139,200,528 (GRCm39)	missense	unknown
R8505:Ubr4	UTSW	4	139,156,880 (GRCm39)	missense
R8519:Ubr4	UTSW	4	139,143,958 (GRCm39)	missense	probably damaging	0.97
R8716:Ubr4	UTSW	4	139,196,164 (GRCm39)	missense	unknown
R8749:Ubr4	UTSW	4	139,129,935 (GRCm39)	missense	probably damaging	0.98
R8768:Ubr4	UTSW	4	139,149,076 (GRCm39)	missense
R8789:Ubr4	UTSW	4	139,137,494 (GRCm39)	missense	possibly damaging	0.76
R8879:Ubr4	UTSW	4	139,137,829 (GRCm39)	missense	probably benign	0.06
R8937:Ubr4	UTSW	4	139,190,886 (GRCm39)	missense	probably damaging	0.97
R9006:Ubr4	UTSW	4	139,172,003 (GRCm39)	critical splice donor site	probably null
R9116:Ubr4	UTSW	4	139,145,785 (GRCm39)	missense
R9134:Ubr4	UTSW	4	139,127,755 (GRCm39)	critical splice donor site	probably null
R9251:Ubr4	UTSW	4	139,177,636 (GRCm39)	missense
R9340:Ubr4	UTSW	4	139,182,763 (GRCm39)	missense	unknown
R9384:Ubr4	UTSW	4	139,194,631 (GRCm39)	missense	unknown
R9389:Ubr4	UTSW	4	139,153,235 (GRCm39)	missense
R9393:Ubr4	UTSW	4	139,212,613 (GRCm39)	missense	unknown
R9531:Ubr4	UTSW	4	139,135,217 (GRCm39)	missense	probably benign	0.00
R9573:Ubr4	UTSW	4	139,148,450 (GRCm39)	missense
R9604:Ubr4	UTSW	4	139,159,827 (GRCm39)	critical splice donor site	probably null
R9613:Ubr4	UTSW	4	139,149,073 (GRCm39)	missense
R9623:Ubr4	UTSW	4	139,159,024 (GRCm39)	missense	probably benign	0.00
R9651:Ubr4	UTSW	4	139,206,859 (GRCm39)	missense	unknown
R9685:Ubr4	UTSW	4	139,191,341 (GRCm39)	missense	unknown
R9698:Ubr4	UTSW	4	139,167,975 (GRCm39)	missense
R9700:Ubr4	UTSW	4	139,119,388 (GRCm39)	missense	probably damaging	0.97
R9727:Ubr4	UTSW	4	139,140,735 (GRCm39)	missense	probably damaging	0.98
R9766:Ubr4	UTSW	4	139,194,595 (GRCm39)	missense	unknown
T0975:Ubr4	UTSW	4	139,179,092 (GRCm39)	missense	probably damaging	1.00
X0028:Ubr4	UTSW	4	139,137,582 (GRCm39)	critical splice donor site	probably null
Z1176:Ubr4	UTSW	4	139,137,456 (GRCm39)	missense	probably damaging	1.00
Z1176:Ubr4	UTSW	4	139,129,971 (GRCm39)	missense	probably benign	0.04
Z1176:Ubr4	UTSW	4	139,127,696 (GRCm39)	missense	probably damaging	1.00
Z1177:Ubr4	UTSW	4	139,177,792 (GRCm39)	missense
Z1186:Ubr4	UTSW	4	139,137,964 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ATGGTAGCTCTGCTTCTTCG -3'
(R):5'- GAGACTAGAGCCCAACTGTC -3'

Sequencing Primer
(F):5'- GCTTCTTCGTAGGCACAACACG -3'
(R):5'- TAGAGCCCAACTGTCCGAAG -3'

Posted On

2021-04-30