Incidental Mutation 'R8720:Casc1'
ID 670068
Institutional Source Beutler Lab
Gene Symbol Casc1
Ensembl Gene ENSMUSG00000043541
Gene Name cancer susceptibility candidate 1
Synonyms A230084G12Rik, Las1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R8720 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 145174834-145211005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 145205257 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 30 (R30S)
Ref Sequence ENSEMBL: ENSMUSP00000144783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000204105]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000060797
AA Change: R30S
SMART Domains Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541
AA Change: R30S

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 5.5e-61 PFAM
Pfam:Casc1 241 469 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111727
Predicted Effect unknown
Transcript: ENSMUST00000111728
AA Change: R17S
SMART Domains Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541
AA Change: R17S

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
Pfam:Casc1 228 456 6.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203558
Predicted Effect unknown
Transcript: ENSMUST00000204105
AA Change: R30S
SMART Domains Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541
AA Change: R30S

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 3.4e-57 PFAM
Pfam:Casc1 241 469 2.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205162
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with disruptions of this gene display a higher incidence of lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,613,441 F1095S possibly damaging Het
Aldh3a1 T C 11: 61,213,479 V64A probably benign Het
Anln T C 9: 22,373,277 H379R probably benign Het
Asb2 A G 12: 103,325,421 Y416H probably damaging Het
Atp2b4 TTCTTC TTCTTCGTCTTC 1: 133,701,727 probably benign Het
Chsy1 T A 7: 66,171,340 M441K possibly damaging Het
Cmas A G 6: 142,771,203 K274E probably damaging Het
Cmip A G 8: 117,411,271 Y75C probably damaging Het
Col17a1 T A 19: 47,649,092 probably benign Het
Col3a1 A G 1: 45,347,733 Y1368C unknown Het
Cspg4 C T 9: 56,887,513 T844I probably benign Het
Ect2 A T 3: 27,115,498 N766K probably damaging Het
Fanci C A 7: 79,439,677 Q954K possibly damaging Het
Gm30083 A G 14: 34,014,938 S21P probably benign Het
Gm5724 A T 6: 141,723,126 S527T probably benign Het
Gulo C T 14: 65,987,625 E422K probably benign Het
Helq A G 5: 100,766,695 V977A probably damaging Het
Herc1 A G 9: 66,481,823 D3874G probably benign Het
Hsf4 G T 8: 105,269,973 D34Y probably damaging Het
Il18 G A 9: 50,565,384 probably benign Het
Il22ra2 A T 10: 19,632,851 E209V probably damaging Het
Ino80 A T 2: 119,402,387 L1150Q probably damaging Het
Kif16b A G 2: 142,849,872 F231L probably damaging Het
Krtap19-4 A G 16: 88,884,958 Y37H unknown Het
Lama4 A T 10: 39,095,083 D1548V probably damaging Het
Lrig2 C T 3: 104,511,682 A4T probably damaging Het
Lrp4 A T 2: 91,494,114 I1265F probably damaging Het
Muc16 T A 9: 18,641,600 T4466S probably benign Het
Myo1e A G 9: 70,297,288 I57V possibly damaging Het
Naip2 A T 13: 100,162,122 Y469N probably benign Het
Nav1 G A 1: 135,460,726 R1065C unknown Het
Nps C T 7: 135,272,316 R72C probably damaging Het
Nup210l G A 3: 90,210,374 V1796I probably benign Het
Pdzd7 T C 19: 45,036,228 K451E probably benign Het
Pigv A T 4: 133,665,657 D67E probably damaging Het
Pik3cg A T 12: 32,193,689 F928I probably benign Het
Pkn3 A G 2: 30,085,184 N486D probably benign Het
Ppp2r3a A G 9: 101,211,885 L413P probably damaging Het
Rbm45 G T 2: 76,380,367 R414L probably damaging Het
Sap30l A T 11: 57,808,049 N116I probably damaging Het
Slc17a5 A T 9: 78,578,663 F47I probably damaging Het
Srbd1 A T 17: 86,051,143 D659E probably damaging Het
Sycp3 A G 10: 88,462,532 Q40R probably benign Het
Trip13 T C 13: 73,915,471 S374G probably benign Het
Ubr4 T C 4: 139,480,838 probably null Het
Ush2a G A 1: 188,358,518 V449I probably benign Het
Vmn1r211 A T 13: 22,851,861 V212D probably damaging Het
Vmn2r111 T A 17: 22,573,213 I21F possibly damaging Het
Zmiz2 A T 11: 6,399,904 I491F possibly damaging Het
Other mutations in Casc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Casc1 APN 6 145175290 missense probably benign 0.00
IGL00586:Casc1 APN 6 145191576 missense possibly damaging 0.53
IGL01066:Casc1 APN 6 145176222 missense probably damaging 0.96
IGL01413:Casc1 APN 6 145175086 missense probably damaging 1.00
IGL02275:Casc1 APN 6 145177364 missense probably damaging 1.00
IGL02668:Casc1 APN 6 145205257 missense unknown
IGL03018:Casc1 APN 6 145183305 missense probably damaging 1.00
IGL03233:Casc1 APN 6 145181885 missense probably damaging 1.00
R0011:Casc1 UTSW 6 145179055 missense probably damaging 1.00
R0011:Casc1 UTSW 6 145179055 missense probably damaging 1.00
R0180:Casc1 UTSW 6 145183218 critical splice donor site probably benign
R0786:Casc1 UTSW 6 145181757 critical splice donor site probably null
R1916:Casc1 UTSW 6 145176200 missense probably benign 0.37
R2117:Casc1 UTSW 6 145205241 critical splice donor site probably null
R2174:Casc1 UTSW 6 145175170 missense probably damaging 1.00
R2264:Casc1 UTSW 6 145208429 utr 5 prime probably benign
R4393:Casc1 UTSW 6 145194578 missense possibly damaging 0.49
R4467:Casc1 UTSW 6 145183218 critical splice donor site probably null
R4847:Casc1 UTSW 6 145175185 missense probably damaging 1.00
R5014:Casc1 UTSW 6 145183266 missense probably damaging 1.00
R5207:Casc1 UTSW 6 145179068 missense probably damaging 1.00
R5264:Casc1 UTSW 6 145181776 missense probably benign 0.02
R5359:Casc1 UTSW 6 145196892 missense probably damaging 1.00
R5499:Casc1 UTSW 6 145177431 missense probably damaging 1.00
R6211:Casc1 UTSW 6 145200491 missense probably damaging 1.00
R6579:Casc1 UTSW 6 145179018 missense probably benign 0.19
R6939:Casc1 UTSW 6 145175219 missense possibly damaging 0.46
R7108:Casc1 UTSW 6 145185865 nonsense probably null
R7131:Casc1 UTSW 6 145177406 missense probably null 0.97
R7810:Casc1 UTSW 6 145194586 missense probably benign 0.28
R8017:Casc1 UTSW 6 145194557 missense probably damaging 1.00
R8385:Casc1 UTSW 6 145175192 missense probably damaging 1.00
R8680:Casc1 UTSW 6 145181816 missense probably benign 0.13
R9118:Casc1 UTSW 6 145175174 missense probably damaging 1.00
R9118:Casc1 UTSW 6 145175245 missense probably damaging 1.00
R9172:Casc1 UTSW 6 145177449 missense probably benign
R9290:Casc1 UTSW 6 145202962 missense unknown
X0063:Casc1 UTSW 6 145175271 missense probably benign 0.13
Z1176:Casc1 UTSW 6 145205293 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACTTCAGTGCACGCTCAG -3'
(R):5'- GTGCTGACACAAATTAGCTGTC -3'

Sequencing Primer
(F):5'- ACGCTCAGGTGTGGCTG -3'
(R):5'- TTGTAAGCTGCCTGACATGGACC -3'
Posted On 2021-04-30