Incidental Mutation 'R8778:Ccdc36'
ID670125
Institutional Source Beutler Lab
Gene Symbol Ccdc36
Ensembl Gene ENSMUSG00000047220
Gene Namecoiled-coil domain containing 36
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R8778 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108403611-108428484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108405608 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 294 (S294P)
Ref Sequence ENSEMBL: ENSMUSP00000075898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076592] [ENSMUST00000192995]
Predicted Effect probably damaging
Transcript: ENSMUST00000076592
AA Change: S294P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075898
Gene: ENSMUSG00000047220
AA Change: S294P

DomainStartEndE-ValueType
Pfam:DUF4700 19 572 4.7e-274 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192995
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,457 E208V probably damaging Het
6720489N17Rik T C 13: 62,605,355 K73E possibly damaging Het
A430033K04Rik T A 5: 138,646,887 C345S possibly damaging Het
Acod1 A G 14: 103,055,482 T481A probably benign Het
Adamtsl1 T C 4: 85,514,450 V5A probably benign Het
Ahnak2 T A 12: 112,783,158 Q1023L Het
Akt1 C T 12: 112,658,668 E149K probably benign Het
Arhgap10 T C 8: 77,413,611 E240G probably damaging Het
Asap1 G A 15: 64,127,409 P516S probably benign Het
Ccdc88c T C 12: 100,945,224 R784G probably benign Het
Cep290 T A 10: 100,514,512 L656* probably null Het
Chd2 A C 7: 73,429,735 S1806A possibly damaging Het
Cyp4f15 G T 17: 32,702,404 A475S probably damaging Het
Dnah12 A G 14: 26,734,563 T814A probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Eif4g1 G A 16: 20,673,446 probably benign Het
Entpd8 G A 2: 25,081,846 V9I probably benign Het
Frmd4a C T 2: 4,473,215 T65M probably damaging Het
Gabrr2 T C 4: 33,095,517 Y469H probably damaging Het
Gjd3 T C 11: 98,983,016 M1V probably null Het
Golga7 T C 8: 23,245,928 N101D possibly damaging Het
Hebp1 A G 6: 135,168,070 F10L probably benign Het
Hs3st3a1 T A 11: 64,436,425 V120E probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Inhbc A G 10: 127,357,824 S108P probably damaging Het
Itgbl1 T A 14: 123,840,663 D188E probably benign Het
Lmo7 T G 14: 101,912,067 S1091A probably damaging Het
Lmo7 T C 14: 101,919,219 V1275A probably benign Het
Lrrc25 T G 8: 70,617,592 L8V possibly damaging Het
Lyst T C 13: 13,635,776 I677T possibly damaging Het
Lyst A G 13: 13,728,567 N3174S possibly damaging Het
Mgst3 C T 1: 167,375,463 V80I probably benign Het
Mtmr12 A G 15: 12,269,920 N698S probably benign Het
Myo18a A G 11: 77,823,324 Y748C probably damaging Het
Myoz2 T C 3: 123,006,507 N224S possibly damaging Het
Nebl T C 2: 17,404,267 Y340C probably damaging Het
Olfr63 T C 17: 33,269,446 S241P probably damaging Het
Pcdha9 G T 18: 36,999,191 V438L possibly damaging Het
Pramef12 T C 4: 144,392,896 D367G probably damaging Het
Sfrp2 T G 3: 83,766,786 L82R probably damaging Het
Spata7 T A 12: 98,658,556 L239Q probably damaging Het
Syncrip A T 9: 88,456,241 I590N unknown Het
Syne1 T C 10: 5,359,066 T648A probably benign Het
Tmc5 A G 7: 118,623,593 Y172C unknown Het
Trim30a A T 7: 104,411,565 Y335N probably benign Het
Trmt10c A G 16: 56,035,009 S88P probably benign Het
Trpc3 T C 3: 36,670,921 E302G probably damaging Het
Ttn T C 2: 76,761,236 T21030A possibly damaging Het
Uba6 G T 5: 86,112,697 P1039T possibly damaging Het
Vmn2r75 A T 7: 86,164,289 I435N probably benign Het
Zkscan5 T C 5: 145,218,332 V271A probably benign Het
Other mutations in Ccdc36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01956:Ccdc36 APN 9 108417319 splice site probably benign
IGL02138:Ccdc36 APN 9 108406621 missense probably benign 0.00
IGL02305:Ccdc36 APN 9 108405832 missense possibly damaging 0.82
IGL02456:Ccdc36 APN 9 108406621 missense probably benign 0.00
IGL02936:Ccdc36 APN 9 108412503 missense possibly damaging 0.69
IGL03150:Ccdc36 APN 9 108404956 missense probably damaging 0.98
IGL03163:Ccdc36 APN 9 108404933 missense probably benign 0.00
IGL03280:Ccdc36 APN 9 108404900 missense possibly damaging 0.92
R0139:Ccdc36 UTSW 9 108412496 missense probably damaging 1.00
R0276:Ccdc36 UTSW 9 108428440 missense possibly damaging 0.84
R0744:Ccdc36 UTSW 9 108404801 missense probably benign
R0836:Ccdc36 UTSW 9 108404801 missense probably benign
R1792:Ccdc36 UTSW 9 108404912 missense possibly damaging 0.84
R1918:Ccdc36 UTSW 9 108412985 missense probably benign 0.16
R2284:Ccdc36 UTSW 9 108421473 missense probably damaging 1.00
R2401:Ccdc36 UTSW 9 108413006 missense possibly damaging 0.53
R4731:Ccdc36 UTSW 9 108405385 missense probably benign 0.00
R4819:Ccdc36 UTSW 9 108406678 missense probably benign 0.10
R4950:Ccdc36 UTSW 9 108421510 missense probably damaging 1.00
R4968:Ccdc36 UTSW 9 108412514 missense probably benign 0.11
R7131:Ccdc36 UTSW 9 108417420 missense probably benign 0.01
R7201:Ccdc36 UTSW 9 108404775 missense probably damaging 0.98
R7950:Ccdc36 UTSW 9 108405671 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGCTTCTGGTGGTCATGAC -3'
(R):5'- AGAACTTGCAGCAGTTTTGTGAC -3'

Sequencing Primer
(F):5'- GTCATGACCCAGTTCTTGCAGTAAG -3'
(R):5'- TTTGTGACAACCTGAGCCAG -3'
Posted On2021-04-30