Incidental Mutation 'R8778:Mtmr12'
ID670145
Institutional Source Beutler Lab
Gene Symbol Mtmr12
Ensembl Gene ENSMUSG00000039458
Gene Namemyotubularin related protein 12
SynonymsPip3ap, C730015A02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8778 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location12205028-12274496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12269920 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 698 (N698S)
Ref Sequence ENSEMBL: ENSMUSP00000041227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038172] [ENSMUST00000071993] [ENSMUST00000174160] [ENSMUST00000174418]
Predicted Effect probably benign
Transcript: ENSMUST00000038172
AA Change: N698S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000041227
Gene: ENSMUSG00000039458
AA Change: N698S

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 33 42 N/A INTRINSIC
Pfam:Myotub-related 182 501 7.6e-55 PFAM
Pfam:3-PAP 559 687 3.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071993
AA Change: N388S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000071883
Gene: ENSMUSG00000039458
AA Change: N388S

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:Myotub-related 17 193 7.8e-53 PFAM
Pfam:3-PAP 249 380 8.8e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174160
SMART Domains Protein: ENSMUSP00000134293
Gene: ENSMUSG00000039458

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 33 42 N/A INTRINSIC
Pfam:Myotub-related 182 501 3.2e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174418
SMART Domains Protein: ENSMUSP00000133285
Gene: ENSMUSG00000039458

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 33 42 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositide 3-kinase-derived membrane-anchored phosphatidylinositides, such as phosphatidylinositol 3-phosphate (PtdIns(3)P), regulate diverse cellular processes. The protein encoded by this gene functions as an adaptor subunit in a complex with an active PtdIns(3)P 3-phosphatase. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik T A 10: 22,067,457 E208V probably damaging Het
6720489N17Rik T C 13: 62,605,355 K73E possibly damaging Het
A430033K04Rik T A 5: 138,646,887 C345S possibly damaging Het
Acod1 A G 14: 103,055,482 T481A probably benign Het
Adamtsl1 T C 4: 85,514,450 V5A probably benign Het
Ahnak2 T A 12: 112,783,158 Q1023L Het
Akt1 C T 12: 112,658,668 E149K probably benign Het
Arhgap10 T C 8: 77,413,611 E240G probably damaging Het
Asap1 G A 15: 64,127,409 P516S probably benign Het
Ccdc36 A G 9: 108,405,608 S294P probably damaging Het
Ccdc88c T C 12: 100,945,224 R784G probably benign Het
Cep290 T A 10: 100,514,512 L656* probably null Het
Chd2 A C 7: 73,429,735 S1806A possibly damaging Het
Cyp4f15 G T 17: 32,702,404 A475S probably damaging Het
Dnah12 A G 14: 26,734,563 T814A probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Eif4g1 G A 16: 20,673,446 probably benign Het
Entpd8 G A 2: 25,081,846 V9I probably benign Het
Frmd4a C T 2: 4,473,215 T65M probably damaging Het
Gabrr2 T C 4: 33,095,517 Y469H probably damaging Het
Gjd3 T C 11: 98,983,016 M1V probably null Het
Gm9758 C T 5: 14,914,699 R44Q probably damaging Het
Golga7 T C 8: 23,245,928 N101D possibly damaging Het
Hebp1 A G 6: 135,168,070 F10L probably benign Het
Hs3st3a1 T A 11: 64,436,425 V120E probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Inhbc A G 10: 127,357,824 S108P probably damaging Het
Itgbl1 T A 14: 123,840,663 D188E probably benign Het
Lmo7 T C 14: 101,919,219 V1275A probably benign Het
Lmo7 T G 14: 101,912,067 S1091A probably damaging Het
Lrrc25 T G 8: 70,617,592 L8V possibly damaging Het
Lyst T C 13: 13,635,776 I677T possibly damaging Het
Lyst A G 13: 13,728,567 N3174S possibly damaging Het
Mgst3 C T 1: 167,375,463 V80I probably benign Het
Myo18a A G 11: 77,823,324 Y748C probably damaging Het
Myoz2 T C 3: 123,006,507 N224S possibly damaging Het
Nebl T C 2: 17,404,267 Y340C probably damaging Het
Olfr63 T C 17: 33,269,446 S241P probably damaging Het
Pcdha9 G T 18: 36,999,191 V438L possibly damaging Het
Pramef12 T C 4: 144,392,896 D367G probably damaging Het
Sfrp2 T G 3: 83,766,786 L82R probably damaging Het
Spata7 T A 12: 98,658,556 L239Q probably damaging Het
Syncrip A T 9: 88,456,241 I590N unknown Het
Syne1 T C 10: 5,359,066 T648A probably benign Het
Tmc5 A G 7: 118,623,593 Y172C unknown Het
Trim30a A T 7: 104,411,565 Y335N probably benign Het
Trmt10c A G 16: 56,035,009 S88P probably benign Het
Trpc3 T C 3: 36,670,921 E302G probably damaging Het
Ttn T C 2: 76,761,236 T21030A possibly damaging Het
Uba6 G T 5: 86,112,697 P1039T possibly damaging Het
Vmn2r75 A T 7: 86,164,289 I435N probably benign Het
Zkscan5 T C 5: 145,218,332 V271A probably benign Het
Other mutations in Mtmr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01801:Mtmr12 APN 15 12269959 missense probably damaging 1.00
IGL02158:Mtmr12 APN 15 12237930 missense probably damaging 1.00
pius UTSW 15 12245011 missense probably damaging 1.00
R0281:Mtmr12 UTSW 15 12257706 nonsense probably null
R1739:Mtmr12 UTSW 15 12245019 missense probably benign 0.06
R1876:Mtmr12 UTSW 15 12257630 missense probably damaging 1.00
R2284:Mtmr12 UTSW 15 12245011 missense probably damaging 1.00
R4301:Mtmr12 UTSW 15 12236020 missense possibly damaging 0.95
R4424:Mtmr12 UTSW 15 12230314 missense probably damaging 0.98
R4617:Mtmr12 UTSW 15 12270046 missense probably damaging 1.00
R5418:Mtmr12 UTSW 15 12269959 missense probably damaging 1.00
R6316:Mtmr12 UTSW 15 12236113 missense probably null 0.31
R6857:Mtmr12 UTSW 15 12263832 missense probably damaging 1.00
R7068:Mtmr12 UTSW 15 12257670 missense probably null 0.08
R7511:Mtmr12 UTSW 15 12265595 missense possibly damaging 0.94
R7515:Mtmr12 UTSW 15 12269951 missense probably damaging 1.00
R7607:Mtmr12 UTSW 15 12257708 nonsense probably null
R7709:Mtmr12 UTSW 15 12245011 missense probably damaging 1.00
R8217:Mtmr12 UTSW 15 12259640 missense possibly damaging 0.89
R8257:Mtmr12 UTSW 15 12259598 missense possibly damaging 0.89
R8398:Mtmr12 UTSW 15 12265609 missense probably damaging 1.00
RF013:Mtmr12 UTSW 15 12261898 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATCAAGGTGTGGGCTCAG -3'
(R):5'- AGTCCAGGGAACAACTGTCC -3'

Sequencing Primer
(F):5'- CAGCGCTATTTACGTTGGATTCCAG -3'
(R):5'- GTCCCACCATACAGTGTGC -3'
Posted On2021-04-30