Incidental Mutation 'R8779:Eif3c'
ID670171
Institutional Source Beutler Lab
Gene Symbol Eif3c
Ensembl Gene ENSMUSG00000030738
Gene Nameeukaryotic translation initiation factor 3, subunit C
SynonymsNIPIL(A3), 3230401O13Rik, 110kDa, Xs, Eif3s8, Xsl
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8779 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location126546455-126566411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126563728 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 128 (K128E)
Ref Sequence ENSEMBL: ENSMUSP00000032992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032992] [ENSMUST00000180459] [ENSMUST00000205949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032992
AA Change: K128E

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032992
Gene: ENSMUSG00000030738
AA Change: K128E

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:eIF-3c_N 29 703 9.6e-267 PFAM
PINT 776 864 9.7e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000180459
AA Change: K128E

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138023
Gene: ENSMUSG00000030738
AA Change: K128E

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 113 126 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000205949
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations in this gene result in a range of abnormal limb development, including polydactyly, and white coat spotting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap1 C A 5: 139,273,418 C338F probably damaging Het
Ahsa1 A G 12: 87,273,199 N256S probably benign Het
Ambra1 A G 2: 91,917,374 I1152V probably benign Het
Ank2 A T 3: 126,965,102 N149K probably damaging Het
Arid1b G A 17: 5,341,534 D1727N probably benign Het
Cntn5 A T 9: 10,171,915 F88Y probably benign Het
Cpox G C 16: 58,670,866 E147Q probably damaging Het
Dip2c T C 13: 9,610,809 F902S probably damaging Het
Fat4 A T 3: 38,979,749 I2517F probably damaging Het
Galnt7 T C 8: 57,584,211 N48S probably benign Het
Gcfc2 C T 6: 81,948,317 T571I probably benign Het
Gem T C 4: 11,711,166 V119A possibly damaging Het
Gm3248 A T 14: 5,943,869 N118K probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Igkv14-130 T A 6: 67,791,327 W57R probably damaging Het
Itch T A 2: 155,172,520 D92E probably benign Het
Jakmip1 G C 5: 37,229,328 E1428Q unknown Het
Kazn T C 4: 142,154,545 E128G Het
Lrmp A G 6: 145,138,199 E30G probably benign Het
Myo3a C A 2: 22,245,593 Y90* probably null Het
Npas2 A C 1: 39,338,186 D543A probably damaging Het
Olfr110 A G 17: 37,498,827 M59V probably damaging Het
Olfr290 A G 7: 84,916,189 T137A possibly damaging Het
Olfr965 A G 9: 39,719,340 T38A probably damaging Het
Pcdhgb4 G T 18: 37,721,782 R410L probably damaging Het
Rexo1 A G 10: 80,548,458 S656P probably benign Het
Rmnd5b T C 11: 51,627,632 E139G possibly damaging Het
Scn1a C T 2: 66,350,913 probably benign Het
Sdk1 T C 5: 141,962,702 S601P probably benign Het
Smpd3 A G 8: 106,265,489 V144A probably benign Het
Snrk T C 9: 122,166,622 I489T probably damaging Het
Thoc1 A G 18: 9,993,366 E575G probably benign Het
Usp16 A G 16: 87,479,409 D545G probably benign Het
Vmn2r81 G A 10: 79,267,384 C137Y possibly damaging Het
Zfp536 T A 7: 37,568,267 K575* probably null Het
Other mutations in Eif3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Eif3c APN 7 126559008 missense probably benign
IGL01380:Eif3c APN 7 126564413 intron probably benign
IGL01434:Eif3c APN 7 126556410 missense probably damaging 0.99
IGL01534:Eif3c APN 7 126557695 missense probably benign 0.07
IGL02493:Eif3c APN 7 126558901 missense probably damaging 0.98
IGL02544:Eif3c APN 7 126547612 nonsense probably null
IGL02821:Eif3c APN 7 126558659 missense probably benign
IGL02963:Eif3c APN 7 126556820 missense probably benign 0.00
R0194:Eif3c UTSW 7 126558623 unclassified probably benign
R0421:Eif3c UTSW 7 126563712 missense possibly damaging 0.95
R1486:Eif3c UTSW 7 126564721 missense probably damaging 1.00
R2378:Eif3c UTSW 7 126552325 missense probably damaging 0.99
R4135:Eif3c UTSW 7 126566299 unclassified probably benign
R4223:Eif3c UTSW 7 126566299 unclassified probably benign
R4225:Eif3c UTSW 7 126566299 unclassified probably benign
R4898:Eif3c UTSW 7 126557454 missense probably benign 0.03
R5144:Eif3c UTSW 7 126563066 missense probably benign
R5246:Eif3c UTSW 7 126557238 missense possibly damaging 0.66
R5845:Eif3c UTSW 7 126564755 missense probably damaging 0.99
R6495:Eif3c UTSW 7 126547500 missense probably damaging 1.00
R6884:Eif3c UTSW 7 126556879 missense probably benign 0.01
R7236:Eif3c UTSW 7 126552323 missense possibly damaging 0.63
R7691:Eif3c UTSW 7 126551990 missense possibly damaging 0.95
R7744:Eif3c UTSW 7 126558894 missense probably damaging 1.00
R8492:Eif3c UTSW 7 126563110 missense probably damaging 1.00
R8523:Eif3c UTSW 7 126547897 missense possibly damaging 0.96
R8827:Eif3c UTSW 7 126558722 missense probably damaging 1.00
X0065:Eif3c UTSW 7 126552085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATCTACCCATGCTCTGG -3'
(R):5'- AGCGCTGCTTAGTTAACAGTC -3'

Sequencing Primer
(F):5'- GAGTTTTGTCGGAGGATCAAACTC -3'
(R):5'- AAGATTAGCATGGCCCCTG -3'
Posted On2021-04-30