Incidental Mutation 'R8779:Olfr965'
ID 670175
Institutional Source Beutler Lab
Gene Symbol Olfr965
Ensembl Gene ENSMUSG00000095839
Gene Name olfactory receptor 965
Synonyms GA_x6K02T2PVTD-33416730-33417668, MOR171-28
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R8779 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 39711353-39720614 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 39719340 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 38 (T38A)
Ref Sequence ENSEMBL: ENSMUSP00000150401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069342] [ENSMUST00000213335] [ENSMUST00000215164]
AlphaFold Q7TRA7
Predicted Effect probably damaging
Transcript: ENSMUST00000069342
AA Change: T38A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069696
Gene: ENSMUSG00000095839
AA Change: T38A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-47 PFAM
Pfam:7tm_1 41 290 4.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213335
AA Change: T38A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215164
AA Change: T38A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap1 C A 5: 139,273,418 C338F probably damaging Het
Ahsa1 A G 12: 87,273,199 N256S probably benign Het
Ambra1 A G 2: 91,917,374 I1152V probably benign Het
Ank2 A T 3: 126,965,102 N149K probably damaging Het
Arid1b G A 17: 5,341,534 D1727N probably benign Het
Cntn5 A T 9: 10,171,915 F88Y probably benign Het
Cpox G C 16: 58,670,866 E147Q probably damaging Het
Dip2c T C 13: 9,610,809 F902S probably damaging Het
Eif3c T C 7: 126,563,728 K128E possibly damaging Het
Fat4 A T 3: 38,979,749 I2517F probably damaging Het
Galnt7 T C 8: 57,584,211 N48S probably benign Het
Gcfc2 C T 6: 81,948,317 T571I probably benign Het
Gem T C 4: 11,711,166 V119A possibly damaging Het
Gm3248 A T 14: 5,943,869 N118K probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Igkv14-130 T A 6: 67,791,327 W57R probably damaging Het
Itch T A 2: 155,172,520 D92E probably benign Het
Jakmip1 G C 5: 37,229,328 E1428Q unknown Het
Kazn T C 4: 142,154,545 E128G Het
Lrmp A G 6: 145,138,199 E30G probably benign Het
Myo3a C A 2: 22,245,593 Y90* probably null Het
Npas2 A C 1: 39,338,186 D543A probably damaging Het
Olfr110 A G 17: 37,498,827 M59V probably damaging Het
Olfr290 A G 7: 84,916,189 T137A possibly damaging Het
Pcdhgb4 G T 18: 37,721,782 R410L probably damaging Het
Rexo1 A G 10: 80,548,458 S656P probably benign Het
Rmnd5b T C 11: 51,627,632 E139G possibly damaging Het
Scn1a C T 2: 66,350,913 probably benign Het
Sdk1 T C 5: 141,962,702 S601P probably benign Het
Smpd3 A G 8: 106,265,489 V144A probably benign Het
Snrk T C 9: 122,166,622 I489T probably damaging Het
Thoc1 A G 18: 9,993,366 E575G probably benign Het
Usp16 A G 16: 87,479,409 D545G probably benign Het
Vmn2r81 G A 10: 79,267,384 C137Y possibly damaging Het
Zfp536 T A 7: 37,568,267 K575* probably null Het
Other mutations in Olfr965
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Olfr965 APN 9 39719581 missense possibly damaging 0.95
IGL02365:Olfr965 APN 9 39719674 missense possibly damaging 0.60
IGL02365:Olfr965 APN 9 39720100 missense probably damaging 0.98
IGL03062:Olfr965 APN 9 39720035 missense probably benign 0.26
IGL03330:Olfr965 APN 9 39719488 missense probably benign 0.08
R0011:Olfr965 UTSW 9 39719627 missense probably benign 0.26
R0462:Olfr965 UTSW 9 39719410 missense probably benign 0.01
R1505:Olfr965 UTSW 9 39719478 missense probably damaging 1.00
R1995:Olfr965 UTSW 9 39719413 missense probably damaging 1.00
R2049:Olfr965 UTSW 9 39720115 missense probably damaging 1.00
R2110:Olfr965 UTSW 9 39719722 missense probably benign 0.30
R3817:Olfr965 UTSW 9 39720108 missense possibly damaging 0.95
R4152:Olfr965 UTSW 9 39720000 missense probably benign 0.10
R4153:Olfr965 UTSW 9 39720000 missense probably benign 0.10
R4351:Olfr965 UTSW 9 39719569 missense probably damaging 0.99
R4377:Olfr965 UTSW 9 39719807 missense probably benign 0.04
R4667:Olfr965 UTSW 9 39719709 missense probably benign 0.09
R5526:Olfr965 UTSW 9 39719596 missense possibly damaging 0.95
R5816:Olfr965 UTSW 9 39719230 start codon destroyed probably null 1.00
R7113:Olfr965 UTSW 9 39719677 missense probably benign
R7336:Olfr965 UTSW 9 39719610 missense probably benign 0.28
R8153:Olfr965 UTSW 9 39719658 missense possibly damaging 0.68
R8291:Olfr965 UTSW 9 39719545 missense probably benign 0.00
R9617:Olfr965 UTSW 9 39719382 missense possibly damaging 0.80
R9631:Olfr965 UTSW 9 39719865 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TTGGCAGCAGAAGACAACC -3'
(R):5'- GTCATGCATTCAGGGTAGGAG -3'

Sequencing Primer
(F):5'- TGTCAAAATCAAGTGCAGAGTGATC -3'
(R):5'- AGGAGATGATGTTCTTCTCTGTCAC -3'
Posted On 2021-04-30