Incidental Mutation 'R8779:Rexo1'
ID670178
Institutional Source Beutler Lab
Gene Symbol Rexo1
Ensembl Gene ENSMUSG00000047417
Gene NameREX1, RNA exonuclease 1
Synonyms2610511M11Rik, Tceb3bp1, 1700021P10Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R8779 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80540922-80561560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80548458 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 656 (S656P)
Ref Sequence ENSEMBL: ENSMUSP00000049705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057910] [ENSMUST00000183160]
Predicted Effect probably benign
Transcript: ENSMUST00000057910
AA Change: S656P

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000049705
Gene: ENSMUSG00000047417
AA Change: S656P

DomainStartEndE-ValueType
low complexity region 34 53 N/A INTRINSIC
coiled coil region 83 113 N/A INTRINSIC
low complexity region 180 188 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
low complexity region 507 525 N/A INTRINSIC
low complexity region 533 551 N/A INTRINSIC
low complexity region 561 583 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
Pfam:EloA-BP1 794 954 3.8e-72 PFAM
EXOIII 1051 1210 2.36e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182260
Predicted Effect probably benign
Transcript: ENSMUST00000183073
Predicted Effect probably benign
Transcript: ENSMUST00000183160
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap1 C A 5: 139,273,418 C338F probably damaging Het
Ahsa1 A G 12: 87,273,199 N256S probably benign Het
Ambra1 A G 2: 91,917,374 I1152V probably benign Het
Ank2 A T 3: 126,965,102 N149K probably damaging Het
Arid1b G A 17: 5,341,534 D1727N probably benign Het
Cntn5 A T 9: 10,171,915 F88Y probably benign Het
Cpox G C 16: 58,670,866 E147Q probably damaging Het
Dip2c T C 13: 9,610,809 F902S probably damaging Het
Eif3c T C 7: 126,563,728 K128E possibly damaging Het
Fat4 A T 3: 38,979,749 I2517F probably damaging Het
Galnt7 T C 8: 57,584,211 N48S probably benign Het
Gcfc2 C T 6: 81,948,317 T571I probably benign Het
Gem T C 4: 11,711,166 V119A possibly damaging Het
Gm3248 A T 14: 5,943,869 N118K probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Igkv14-130 T A 6: 67,791,327 W57R probably damaging Het
Itch T A 2: 155,172,520 D92E probably benign Het
Jakmip1 G C 5: 37,229,328 E1428Q unknown Het
Kazn T C 4: 142,154,545 E128G Het
Lrmp A G 6: 145,138,199 E30G probably benign Het
Myo3a C A 2: 22,245,593 Y90* probably null Het
Npas2 A C 1: 39,338,186 D543A probably damaging Het
Olfr110 A G 17: 37,498,827 M59V probably damaging Het
Olfr290 A G 7: 84,916,189 T137A possibly damaging Het
Olfr965 A G 9: 39,719,340 T38A probably damaging Het
Pcdhgb4 G T 18: 37,721,782 R410L probably damaging Het
Rmnd5b T C 11: 51,627,632 E139G possibly damaging Het
Scn1a C T 2: 66,350,913 probably benign Het
Sdk1 T C 5: 141,962,702 S601P probably benign Het
Smpd3 A G 8: 106,265,489 V144A probably benign Het
Snrk T C 9: 122,166,622 I489T probably damaging Het
Thoc1 A G 18: 9,993,366 E575G probably benign Het
Usp16 A G 16: 87,479,409 D545G probably benign Het
Vmn2r81 G A 10: 79,267,384 C137Y possibly damaging Het
Zfp536 T A 7: 37,568,267 K575* probably null Het
Other mutations in Rexo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Rexo1 APN 10 80550964 missense probably damaging 0.99
IGL01128:Rexo1 APN 10 80549739 missense probably benign
IGL01890:Rexo1 APN 10 80543011 missense possibly damaging 0.85
PIT4453001:Rexo1 UTSW 10 80550397 missense probably damaging 0.97
R0044:Rexo1 UTSW 10 80544378 missense probably benign 0.16
R0365:Rexo1 UTSW 10 80542576 missense probably damaging 0.99
R0573:Rexo1 UTSW 10 80544850 missense probably damaging 1.00
R1146:Rexo1 UTSW 10 80544405 missense probably benign 0.04
R1146:Rexo1 UTSW 10 80544405 missense probably benign 0.04
R1511:Rexo1 UTSW 10 80550050 missense possibly damaging 0.93
R1523:Rexo1 UTSW 10 80542751 missense probably benign 0.41
R1807:Rexo1 UTSW 10 80542579 missense possibly damaging 0.95
R1868:Rexo1 UTSW 10 80542920 missense probably damaging 1.00
R1935:Rexo1 UTSW 10 80550469 missense probably benign 0.00
R1936:Rexo1 UTSW 10 80550469 missense probably benign 0.00
R1957:Rexo1 UTSW 10 80543366 missense probably damaging 0.96
R2084:Rexo1 UTSW 10 80561266 missense probably benign 0.01
R2153:Rexo1 UTSW 10 80544109 nonsense probably null
R2262:Rexo1 UTSW 10 80549569 missense probably benign 0.02
R4471:Rexo1 UTSW 10 80542658 missense probably damaging 1.00
R4472:Rexo1 UTSW 10 80542658 missense probably damaging 1.00
R4690:Rexo1 UTSW 10 80546421 missense probably benign 0.01
R4972:Rexo1 UTSW 10 80549693 missense probably damaging 0.96
R6335:Rexo1 UTSW 10 80544081 missense probably damaging 1.00
R6505:Rexo1 UTSW 10 80543011 missense possibly damaging 0.85
R6615:Rexo1 UTSW 10 80544014 missense possibly damaging 0.68
R6949:Rexo1 UTSW 10 80550636 missense possibly damaging 0.46
R7612:Rexo1 UTSW 10 80549663 missense probably benign 0.40
R7807:Rexo1 UTSW 10 80550136 missense probably benign 0.09
R7840:Rexo1 UTSW 10 80550738 missense probably benign
Z1177:Rexo1 UTSW 10 80549775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCCTGTGCCCAGATCTG -3'
(R):5'- TCTGAACTGTCATCCTGGGC -3'

Sequencing Primer
(F):5'- TGGTGGCAAATCTCCTTC -3'
(R):5'- TAGGGCTCTCATTGGCAGGAC -3'
Posted On2021-04-30