Incidental Mutation 'R8779:Usp16'
ID670184
Institutional Source Beutler Lab
Gene Symbol Usp16
Ensembl Gene ENSMUSG00000025616
Gene Nameubiquitin specific peptidase 16
Synonyms2810483I07Rik, 1200004E02Rik, UBP-M, 6330514E22Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8779 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location87454703-87483517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87479409 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 545 (D545G)
Ref Sequence ENSEMBL: ENSMUSP00000026710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026704] [ENSMUST00000026710] [ENSMUST00000119504] [ENSMUST00000144759] [ENSMUST00000175977] [ENSMUST00000177376]
Predicted Effect probably benign
Transcript: ENSMUST00000026704
SMART Domains Protein: ENSMUSP00000026704
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 39 529 6.7e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026710
AA Change: D545G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026710
Gene: ENSMUSG00000025616
AA Change: D545G

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2.5e-23 PFAM
coiled coil region 149 182 N/A INTRINSIC
Pfam:UCH 194 821 2e-54 PFAM
Pfam:UCH_1 195 800 3.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119504
AA Change: D544G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114058
Gene: ENSMUSG00000025616
AA Change: D544G

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 6.9e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 732 1.2e-36 PFAM
Pfam:UCH_1 194 737 2.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144759
SMART Domains Protein: ENSMUSP00000116323
Gene: ENSMUSG00000025616

DomainStartEndE-ValueType
Pfam:zf-UBP 48 127 2e-24 PFAM
coiled coil region 149 181 N/A INTRINSIC
Pfam:UCH 193 330 2.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175977
SMART Domains Protein: ENSMUSP00000135651
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 39 132 4.5e-32 PFAM
Pfam:Cpn60_TCP1 120 470 1.9e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177376
SMART Domains Protein: ENSMUSP00000135498
Gene: ENSMUSG00000025613

DomainStartEndE-ValueType
PDB:4B2T|Q 1 51 1e-29 PDB
SCOP:d1oela1 26 51 8e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquitinating enzyme that is phosphorylated at the onset of mitosis and then dephosphorylated at the metaphase/anaphase transition. It can deubiquitinate H2A, one of two major ubiquitinated proteins of chromatin, in vitro and a mutant form of the protein was shown to block cell division. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap1 C A 5: 139,273,418 C338F probably damaging Het
Ahsa1 A G 12: 87,273,199 N256S probably benign Het
Ambra1 A G 2: 91,917,374 I1152V probably benign Het
Ank2 A T 3: 126,965,102 N149K probably damaging Het
Arid1b G A 17: 5,341,534 D1727N probably benign Het
Cntn5 A T 9: 10,171,915 F88Y probably benign Het
Cpox G C 16: 58,670,866 E147Q probably damaging Het
Dip2c T C 13: 9,610,809 F902S probably damaging Het
Eif3c T C 7: 126,563,728 K128E possibly damaging Het
Fat4 A T 3: 38,979,749 I2517F probably damaging Het
Galnt7 T C 8: 57,584,211 N48S probably benign Het
Gcfc2 C T 6: 81,948,317 T571I probably benign Het
Gem T C 4: 11,711,166 V119A possibly damaging Het
Gm3248 A T 14: 5,943,869 N118K probably benign Het
Idh1 CA CAA 1: 65,165,188 probably null Het
Igkv14-130 T A 6: 67,791,327 W57R probably damaging Het
Itch T A 2: 155,172,520 D92E probably benign Het
Jakmip1 G C 5: 37,229,328 E1428Q unknown Het
Kazn T C 4: 142,154,545 E128G Het
Lrmp A G 6: 145,138,199 E30G probably benign Het
Myo3a C A 2: 22,245,593 Y90* probably null Het
Npas2 A C 1: 39,338,186 D543A probably damaging Het
Olfr110 A G 17: 37,498,827 M59V probably damaging Het
Olfr290 A G 7: 84,916,189 T137A possibly damaging Het
Olfr965 A G 9: 39,719,340 T38A probably damaging Het
Pcdhgb4 G T 18: 37,721,782 R410L probably damaging Het
Rexo1 A G 10: 80,548,458 S656P probably benign Het
Rmnd5b T C 11: 51,627,632 E139G possibly damaging Het
Scn1a C T 2: 66,350,913 probably benign Het
Sdk1 T C 5: 141,962,702 S601P probably benign Het
Smpd3 A G 8: 106,265,489 V144A probably benign Het
Snrk T C 9: 122,166,622 I489T probably damaging Het
Thoc1 A G 18: 9,993,366 E575G probably benign Het
Vmn2r81 G A 10: 79,267,384 C137Y possibly damaging Het
Zfp536 T A 7: 37,568,267 K575* probably null Het
Other mutations in Usp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Usp16 APN 16 87466276 missense possibly damaging 0.95
IGL01589:Usp16 APN 16 87479183 missense probably benign 0.00
IGL02570:Usp16 APN 16 87480893 missense probably damaging 1.00
IGL02736:Usp16 APN 16 87464835 missense possibly damaging 0.75
IGL02973:Usp16 APN 16 87479739 missense probably damaging 1.00
IGL03066:Usp16 APN 16 87471833 missense probably damaging 1.00
PIT1430001:Usp16 UTSW 16 87473132 missense probably damaging 0.99
R0395:Usp16 UTSW 16 87475446 missense probably damaging 1.00
R0619:Usp16 UTSW 16 87472164 missense probably benign 0.02
R1146:Usp16 UTSW 16 87474648 missense possibly damaging 0.93
R1146:Usp16 UTSW 16 87474648 missense possibly damaging 0.93
R1549:Usp16 UTSW 16 87464834 missense probably damaging 1.00
R1557:Usp16 UTSW 16 87462142 critical splice donor site probably null
R1776:Usp16 UTSW 16 87479316 missense probably damaging 0.97
R1818:Usp16 UTSW 16 87479132 nonsense probably null
R1835:Usp16 UTSW 16 87480907 missense probably damaging 1.00
R2022:Usp16 UTSW 16 87473126 missense probably damaging 1.00
R2146:Usp16 UTSW 16 87473187 critical splice donor site probably null
R2432:Usp16 UTSW 16 87466358 critical splice donor site probably null
R3110:Usp16 UTSW 16 87471848 splice site probably null
R3112:Usp16 UTSW 16 87471848 splice site probably null
R3771:Usp16 UTSW 16 87458683 start codon destroyed probably null 1.00
R4353:Usp16 UTSW 16 87470354 missense probably damaging 1.00
R4959:Usp16 UTSW 16 87480914 missense probably damaging 0.99
R4973:Usp16 UTSW 16 87480914 missense probably damaging 0.99
R5276:Usp16 UTSW 16 87470451 critical splice donor site probably null
R5753:Usp16 UTSW 16 87482899 missense probably damaging 0.98
R6230:Usp16 UTSW 16 87464798 missense possibly damaging 0.48
R6267:Usp16 UTSW 16 87483191 missense probably benign 0.00
R6473:Usp16 UTSW 16 87483135 missense probably benign 0.00
R6736:Usp16 UTSW 16 87470397 missense probably damaging 1.00
R7006:Usp16 UTSW 16 87471836 missense probably damaging 1.00
R7012:Usp16 UTSW 16 87458744 critical splice donor site probably null
R7040:Usp16 UTSW 16 87480929 missense probably damaging 1.00
R7136:Usp16 UTSW 16 87483171 missense probably benign
R7295:Usp16 UTSW 16 87472089 missense probably benign 0.44
R7434:Usp16 UTSW 16 87479319 nonsense probably null
R7497:Usp16 UTSW 16 87466286 nonsense probably null
R7571:Usp16 UTSW 16 87464835 missense possibly damaging 0.75
R7576:Usp16 UTSW 16 87479300 missense probably benign 0.34
R7624:Usp16 UTSW 16 87476805 missense probably benign 0.23
R7889:Usp16 UTSW 16 87474584 missense probably benign 0.44
R8499:Usp16 UTSW 16 87474648 missense possibly damaging 0.93
X0061:Usp16 UTSW 16 87479457 missense probably benign 0.01
X0064:Usp16 UTSW 16 87471725 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTGGAAGTGGATACCGACTC -3'
(R):5'- CGAGGGTACAGAAAGCAGTTTC -3'

Sequencing Primer
(F):5'- CCACCCATGGTTCTCAAGAGGAG -3'
(R):5'- CCTCATATACCTTGGGTGCAGAATG -3'
Posted On2021-04-30