Mutagenetix > Incidental Mutation

Incidental Mutation 'R8779:Usp16'

670184

Institutional Source

Beutler Lab

Gene Symbol

Usp16

Ensembl Gene

ENSMUSG00000025616

Gene Name

ubiquitin specific peptidase 16

Synonyms

2810483I07Rik, 1200004E02Rik, UBP-M, 6330514E22Rik

MMRRC Submission

068721-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8779 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87454703-87483517 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87479409 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 545 (D545G)

Ref Sequence

ENSEMBL: ENSMUSP00000026710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026704] [ENSMUST00000026710] [ENSMUST00000119504] [ENSMUST00000144759] [ENSMUST00000175977] [ENSMUST00000177376]

AlphaFold

Q99LG0

Predicted Effect

probably benign
Transcript: ENSMUST00000026704

SMART Domains

Protein: ENSMUSP00000026704
Gene: ENSMUSG00000025613

Domain	Start	End	E-Value	Type
Pfam:Cpn60_TCP1	39	529	6.7e-156	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000026710
AA Change: D545G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000026710
Gene: ENSMUSG00000025616
AA Change: D545G

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	48	127	2.5e-23	PFAM
coiled coil region	149	182	N/A	INTRINSIC
Pfam:UCH	194	821	2e-54	PFAM
Pfam:UCH_1	195	800	3.8e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000119504
AA Change: D544G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000114058
Gene: ENSMUSG00000025616
AA Change: D544G

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	48	127	6.9e-24	PFAM
coiled coil region	149	181	N/A	INTRINSIC
Pfam:UCH	193	732	1.2e-36	PFAM
Pfam:UCH_1	194	737	2.5e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000144759

SMART Domains

Protein: ENSMUSP00000116323
Gene: ENSMUSG00000025616

Domain	Start	End	E-Value	Type
Pfam:zf-UBP	48	127	2e-24	PFAM
coiled coil region	149	181	N/A	INTRINSIC
Pfam:UCH	193	330	2.4e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175977

SMART Domains

Protein: ENSMUSP00000135651
Gene: ENSMUSG00000025613

Domain	Start	End	E-Value	Type
Pfam:Cpn60_TCP1	39	132	4.5e-32	PFAM
Pfam:Cpn60_TCP1	120	470	1.9e-94	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177376

SMART Domains

Protein: ENSMUSP00000135498
Gene: ENSMUSG00000025613

Domain	Start	End	E-Value	Type
PDB:4B2T\|Q	1	51	1e-29	PDB
SCOP:d1oela1	26	51	8e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deubiquitinating enzyme that is phosphorylated at the onset of mitosis and then dephosphorylated at the metaphase/anaphase transition. It can deubiquitinate H2A, one of two major ubiquitinated proteins of chromatin, in vitro and a mutant form of the protein was shown to block cell division. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adap1	C	A	5: 139,273,418	C338F	probably damaging	Het
Ahsa1	A	G	12: 87,273,199	N256S	probably benign	Het
Ambra1	A	G	2: 91,917,374	I1152V	probably benign	Het
Ank2	A	T	3: 126,965,102	N149K	probably damaging	Het
Arid1b	G	A	17: 5,341,534	D1727N	probably benign	Het
Cntn5	A	T	9: 10,171,915	F88Y	probably benign	Het
Cpox	G	C	16: 58,670,866	E147Q	probably damaging	Het
Dip2c	T	C	13: 9,610,809	F902S	probably damaging	Het
Eif3c	T	C	7: 126,563,728	K128E	possibly damaging	Het
Fat4	A	T	3: 38,979,749	I2517F	probably damaging	Het
Galnt7	T	C	8: 57,584,211	N48S	probably benign	Het
Gcfc2	C	T	6: 81,948,317	T571I	probably benign	Het
Gem	T	C	4: 11,711,166	V119A	possibly damaging	Het
Gm3248	A	T	14: 5,943,869	N118K	probably benign	Het
Idh1	CA	CAA	1: 65,165,188		probably null	Het
Igkv14-130	T	A	6: 67,791,327	W57R	probably damaging	Het
Itch	T	A	2: 155,172,520	D92E	probably benign	Het
Jakmip1	G	C	5: 37,229,328	E1428Q	unknown	Het
Kazn	T	C	4: 142,154,545	E128G		Het
Lrmp	A	G	6: 145,138,199	E30G	probably benign	Het
Myo3a	C	A	2: 22,245,593	Y90*	probably null	Het
Npas2	A	C	1: 39,338,186	D543A	probably damaging	Het
Olfr110	A	G	17: 37,498,827	M59V	probably damaging	Het
Olfr290	A	G	7: 84,916,189	T137A	possibly damaging	Het
Olfr965	A	G	9: 39,719,340	T38A	probably damaging	Het
Pcdhgb4	G	T	18: 37,721,782	R410L	probably damaging	Het
Rexo1	A	G	10: 80,548,458	S656P	probably benign	Het
Rmnd5b	T	C	11: 51,627,632	E139G	possibly damaging	Het
Scn1a	C	T	2: 66,350,913		probably benign	Het
Sdk1	T	C	5: 141,962,702	S601P	probably benign	Het
Smpd3	A	G	8: 106,265,489	V144A	probably benign	Het
Snrk	T	C	9: 122,166,622	I489T	probably damaging	Het
Thoc1	A	G	18: 9,993,366	E575G	probably benign	Het
Vmn2r81	G	A	10: 79,267,384	C137Y	possibly damaging	Het
Zfp536	T	A	7: 37,568,267	K575*	probably null	Het

Other mutations in Usp16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01322:Usp16	APN	16	87466276	missense	possibly damaging	0.95
IGL01589:Usp16	APN	16	87479183	missense	probably benign	0.00
IGL02570:Usp16	APN	16	87480893	missense	probably damaging	1.00
IGL02736:Usp16	APN	16	87464835	missense	possibly damaging	0.75
IGL02973:Usp16	APN	16	87479739	missense	probably damaging	1.00
IGL03066:Usp16	APN	16	87471833	missense	probably damaging	1.00
PIT1430001:Usp16	UTSW	16	87473132	missense	probably damaging	0.99
R0395:Usp16	UTSW	16	87475446	missense	probably damaging	1.00
R0619:Usp16	UTSW	16	87472164	missense	probably benign	0.02
R1146:Usp16	UTSW	16	87474648	missense	possibly damaging	0.93
R1146:Usp16	UTSW	16	87474648	missense	possibly damaging	0.93
R1549:Usp16	UTSW	16	87464834	missense	probably damaging	1.00
R1557:Usp16	UTSW	16	87462142	critical splice donor site	probably null
R1776:Usp16	UTSW	16	87479316	missense	probably damaging	0.97
R1818:Usp16	UTSW	16	87479132	nonsense	probably null
R1835:Usp16	UTSW	16	87480907	missense	probably damaging	1.00
R2022:Usp16	UTSW	16	87473126	missense	probably damaging	1.00
R2146:Usp16	UTSW	16	87473187	critical splice donor site	probably null
R2432:Usp16	UTSW	16	87466358	critical splice donor site	probably null
R3110:Usp16	UTSW	16	87471848	splice site	probably null
R3112:Usp16	UTSW	16	87471848	splice site	probably null
R3771:Usp16	UTSW	16	87458683	start codon destroyed	probably null	1.00
R4353:Usp16	UTSW	16	87470354	missense	probably damaging	1.00
R4959:Usp16	UTSW	16	87480914	missense	probably damaging	0.99
R4973:Usp16	UTSW	16	87480914	missense	probably damaging	0.99
R5276:Usp16	UTSW	16	87470451	critical splice donor site	probably null
R5753:Usp16	UTSW	16	87482899	missense	probably damaging	0.98
R6230:Usp16	UTSW	16	87464798	missense	possibly damaging	0.48
R6267:Usp16	UTSW	16	87483191	missense	probably benign	0.00
R6473:Usp16	UTSW	16	87483135	missense	probably benign	0.00
R6736:Usp16	UTSW	16	87470397	missense	probably damaging	1.00
R7006:Usp16	UTSW	16	87471836	missense	probably damaging	1.00
R7012:Usp16	UTSW	16	87458744	critical splice donor site	probably null
R7040:Usp16	UTSW	16	87480929	missense	probably damaging	1.00
R7136:Usp16	UTSW	16	87483171	missense	probably benign
R7295:Usp16	UTSW	16	87472089	missense	probably benign	0.44
R7434:Usp16	UTSW	16	87479319	nonsense	probably null
R7497:Usp16	UTSW	16	87466286	nonsense	probably null
R7571:Usp16	UTSW	16	87464835	missense	possibly damaging	0.75
R7576:Usp16	UTSW	16	87479300	missense	probably benign	0.34
R7624:Usp16	UTSW	16	87476805	missense	probably benign	0.23
R7889:Usp16	UTSW	16	87474584	missense	probably benign	0.44
R8499:Usp16	UTSW	16	87474648	missense	possibly damaging	0.93
R9182:Usp16	UTSW	16	87479654	missense	probably benign	0.00
R9251:Usp16	UTSW	16	87469752	missense	probably benign	0.08
R9367:Usp16	UTSW	16	87464781	missense	probably benign	0.01
R9707:Usp16	UTSW	16	87466347	missense	probably benign
R9746:Usp16	UTSW	16	87479232	missense	probably benign	0.00
X0061:Usp16	UTSW	16	87479457	missense	probably benign	0.01
X0064:Usp16	UTSW	16	87471725	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GTGGAAGTGGATACCGACTC -3'
(R):5'- CGAGGGTACAGAAAGCAGTTTC -3'

Sequencing Primer
(F):5'- CCACCCATGGTTCTCAAGAGGAG -3'
(R):5'- CCTCATATACCTTGGGTGCAGAATG -3'

Posted On

2021-04-30