Incidental Mutation 'R8780:Adgrd1'
ID 670201
Institutional Source Beutler Lab
Gene Symbol Adgrd1
Ensembl Gene ENSMUSG00000044017
Gene Name adhesion G protein-coupled receptor D1
Synonyms E230012M21Rik, Gpr133
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8780 (G1)
Quality Score 174.009
Status Validated
Chromosome 5
Chromosomal Location 129096750-129204599 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) G to A at 129097074 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056617] [ENSMUST00000156437]
AlphaFold Q80T32
Predicted Effect probably benign
Transcript: ENSMUST00000056617
SMART Domains Protein: ENSMUSP00000060307
Gene: ENSMUSG00000044017

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Laminin_G_3 119 273 2.9e-18 PFAM
Pfam:Pentaxin 171 288 2.2e-7 PFAM
GPS 535 585 1.57e-14 SMART
Pfam:Dicty_CAR 590 856 1.2e-8 PFAM
Pfam:7tm_2 592 831 8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156437
SMART Domains Protein: ENSMUSP00000121217
Gene: ENSMUSG00000044017

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adhesion G-protein-coupled receptors (GPCRs), including GPR133, are membrane-bound proteins with long N termini containing multiple domains. GPCRs, or GPRs, contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins (summary by Bjarnadottir et al., 2004 [PubMed 15203201]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 A G 11: 105,997,538 D358G probably damaging Het
Aff4 C A 11: 53,380,617 T327K probably damaging Het
Ajap1 A G 4: 153,386,504 V282A probably damaging Het
Arrb1 A G 7: 99,591,361 D194G probably benign Het
Atp1a3 T C 7: 24,981,554 N836S probably damaging Het
BC024978 T C 7: 27,201,078 S161P probably benign Het
C1ql3 A G 2: 13,010,756 V31A probably benign Het
Cc2d2a A G 5: 43,739,350 T1530A probably damaging Het
Cenpc1 A T 5: 86,016,350 I804K probably damaging Het
Chmp2b G A 16: 65,562,536 probably benign Het
Chrm5 T A 2: 112,480,108 E221V possibly damaging Het
Col22a1 A T 15: 72,006,947 H120Q probably damaging Het
Esp16 C T 17: 39,539,838 A36V probably damaging Het
Fn1 A T 1: 71,643,149 S283T probably benign Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Hipk3 A G 2: 104,433,834 L773S probably damaging Het
Morn3 A G 5: 123,037,762 W188R probably damaging Het
Msantd2 T G 9: 37,523,502 L547R probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1234 A T 2: 89,363,308 N40K probably damaging Het
Olfr857 T C 9: 19,713,357 F177L possibly damaging Het
Pcdhga5 G A 18: 37,695,773 V425I probably benign Het
Pdxk T A 10: 78,447,952 Y136F probably benign Het
Prr14 T C 7: 127,476,238 F503L probably benign Het
Prss54 T C 8: 95,559,429 I339V probably benign Het
Repin1 T C 6: 48,597,139 I334T probably damaging Het
Rnf219 A T 14: 104,479,646 C430* probably null Het
Runx3 A G 4: 135,155,409 D152G probably damaging Het
She T A 3: 89,831,949 I149N probably damaging Het
Stra6 A G 9: 58,134,971 probably benign Het
Svil A G 18: 5,063,449 T907A probably benign Het
Syvn1 A G 19: 6,050,363 D288G probably damaging Het
Tacc1 T C 8: 25,182,061 S384G probably benign Het
Tmc8 ACTTCCT ACT 11: 117,790,732 probably null Het
Trhr T C 15: 44,197,753 I223T possibly damaging Het
Vmn2r45 A G 7: 8,481,372 I478T possibly damaging Het
Zbtb3 G T 19: 8,803,809 R262M possibly damaging Het
Zfp516 T C 18: 82,987,955 S995P probably benign Het
Zfp985 A G 4: 147,583,955 I427V possibly damaging Het
Other mutations in Adgrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Adgrd1 APN 5 129139592 missense probably benign 0.06
IGL01384:Adgrd1 APN 5 129097209 missense possibly damaging 0.47
IGL01636:Adgrd1 APN 5 129142452 splice site probably benign
IGL01916:Adgrd1 APN 5 129132838 missense probably benign 0.12
IGL01923:Adgrd1 APN 5 129178079 missense possibly damaging 0.58
IGL02019:Adgrd1 APN 5 129115138 missense probably benign 0.00
IGL02142:Adgrd1 APN 5 129131584 missense probably benign
IGL02149:Adgrd1 APN 5 129179261 missense probably damaging 1.00
IGL02190:Adgrd1 APN 5 129140724 splice site probably benign
IGL02623:Adgrd1 APN 5 129132745 missense probably damaging 0.99
IGL02696:Adgrd1 APN 5 129140854 splice site probably benign
IGL02850:Adgrd1 APN 5 129115055 missense probably damaging 1.00
IGL02976:Adgrd1 APN 5 129131597 missense probably benign 0.00
IGL02988:Adgrd1 UTSW 5 129144010 missense probably benign 0.00
PIT4458001:Adgrd1 UTSW 5 129131577 missense probably damaging 1.00
R0081:Adgrd1 UTSW 5 129178082 missense probably damaging 0.99
R0266:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0267:Adgrd1 UTSW 5 129139594 missense probably benign 0.00
R0464:Adgrd1 UTSW 5 129162650 missense probably damaging 1.00
R0625:Adgrd1 UTSW 5 129171931 critical splice donor site probably null
R1288:Adgrd1 UTSW 5 129129007 missense probably damaging 0.97
R1460:Adgrd1 UTSW 5 129122563 missense possibly damaging 0.63
R1635:Adgrd1 UTSW 5 129128907 missense probably damaging 1.00
R1658:Adgrd1 UTSW 5 129178100 missense probably benign 0.02
R1709:Adgrd1 UTSW 5 129179228 missense possibly damaging 0.95
R1897:Adgrd1 UTSW 5 129129001 missense probably benign 0.01
R1976:Adgrd1 UTSW 5 129140797 missense probably benign 0.06
R2049:Adgrd1 UTSW 5 129115095 missense probably benign 0.01
R2259:Adgrd1 UTSW 5 129112311 missense possibly damaging 0.92
R2295:Adgrd1 UTSW 5 129122506 missense probably benign 0.13
R3076:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3077:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R3078:Adgrd1 UTSW 5 129129105 missense probably benign 0.20
R4581:Adgrd1 UTSW 5 129202531 missense possibly damaging 0.68
R5024:Adgrd1 UTSW 5 129171895 missense probably damaging 1.00
R5076:Adgrd1 UTSW 5 129143989 nonsense probably null
R5227:Adgrd1 UTSW 5 129122583 missense probably benign 0.00
R5453:Adgrd1 UTSW 5 129179583 missense probably damaging 0.99
R6349:Adgrd1 UTSW 5 129142539 splice site probably null
R6953:Adgrd1 UTSW 5 129115078 nonsense probably null
R7300:Adgrd1 UTSW 5 129097347 critical splice donor site probably null
R7583:Adgrd1 UTSW 5 129179588 missense probably benign 0.42
R7622:Adgrd1 UTSW 5 129139624 missense probably benign 0.27
R8205:Adgrd1 UTSW 5 129115111 missense possibly damaging 0.94
R8716:Adgrd1 UTSW 5 129188371 missense possibly damaging 0.94
R8850:Adgrd1 UTSW 5 129142510 missense probably benign 0.00
R9528:Adgrd1 UTSW 5 129179676 missense probably benign 0.44
R9569:Adgrd1 UTSW 5 129179637 missense possibly damaging 0.90
R9626:Adgrd1 UTSW 5 129198657 missense probably damaging 1.00
X0067:Adgrd1 UTSW 5 129188352 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GACACAGACTCCTAAGCCTGTAGG -3'
(R):5'- TTGGAGGCCAAGAGCGTTAC -3'

Sequencing Primer
(F):5'- CATCAGCAGCCAGAGCCTTG -3'
(R):5'- CGTTACCTGGACGCTGCAAAAG -3'
Posted On 2021-04-30