Incidental Mutation 'R8780:Aff4'
ID 670214
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8780 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 53350833-53421830 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 53380617 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 327 (T327K)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
AlphaFold Q9ESC8
Predicted Effect probably damaging
Transcript: ENSMUST00000060945
AA Change: T327K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: T327K

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152616
SMART Domains Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470

DomainStartEndE-ValueType
Pfam:AF-4 1 51 4e-15 PFAM
Pfam:AF-4 46 159 1.3e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 A G 11: 105,997,538 D358G probably damaging Het
Adgrd1 G A 5: 129,097,074 probably benign Het
Ajap1 A G 4: 153,386,504 V282A probably damaging Het
Arrb1 A G 7: 99,591,361 D194G probably benign Het
Atp1a3 T C 7: 24,981,554 N836S probably damaging Het
BC024978 T C 7: 27,201,078 S161P probably benign Het
C1ql3 A G 2: 13,010,756 V31A probably benign Het
Cc2d2a A G 5: 43,739,350 T1530A probably damaging Het
Cenpc1 A T 5: 86,016,350 I804K probably damaging Het
Chmp2b G A 16: 65,562,536 probably benign Het
Chrm5 T A 2: 112,480,108 E221V possibly damaging Het
Col22a1 A T 15: 72,006,947 H120Q probably damaging Het
Esp16 C T 17: 39,539,838 A36V probably damaging Het
Fn1 A T 1: 71,643,149 S283T probably benign Het
Gm340 C T 19: 41,585,259 R818W probably damaging Het
Hipk3 A G 2: 104,433,834 L773S probably damaging Het
Morn3 A G 5: 123,037,762 W188R probably damaging Het
Msantd2 T G 9: 37,523,502 L547R probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1234 A T 2: 89,363,308 N40K probably damaging Het
Olfr857 T C 9: 19,713,357 F177L possibly damaging Het
Pcdhga5 G A 18: 37,695,773 V425I probably benign Het
Pdxk T A 10: 78,447,952 Y136F probably benign Het
Prr14 T C 7: 127,476,238 F503L probably benign Het
Prss54 T C 8: 95,559,429 I339V probably benign Het
Repin1 T C 6: 48,597,139 I334T probably damaging Het
Rnf219 A T 14: 104,479,646 C430* probably null Het
Runx3 A G 4: 135,155,409 D152G probably damaging Het
She T A 3: 89,831,949 I149N probably damaging Het
Stra6 A G 9: 58,134,971 probably benign Het
Svil A G 18: 5,063,449 T907A probably benign Het
Syvn1 A G 19: 6,050,363 D288G probably damaging Het
Tacc1 T C 8: 25,182,061 S384G probably benign Het
Tmc8 ACTTCCT ACT 11: 117,790,732 probably null Het
Trhr T C 15: 44,197,753 I223T possibly damaging Het
Vmn2r45 A G 7: 8,481,372 I478T possibly damaging Het
Zbtb3 G T 19: 8,803,809 R262M possibly damaging Het
Zfp516 T C 18: 82,987,955 S995P probably benign Het
Zfp985 A G 4: 147,583,955 I427V possibly damaging Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
R7848:Aff4 UTSW 11 53404512 missense probably benign 0.05
R7968:Aff4 UTSW 11 53409348 missense probably damaging 1.00
R8159:Aff4 UTSW 11 53411894 missense possibly damaging 0.71
R8218:Aff4 UTSW 11 53398257 missense probably damaging 0.98
R8241:Aff4 UTSW 11 53400171 missense probably benign 0.00
R8284:Aff4 UTSW 11 53404552 missense probably damaging 0.99
R8373:Aff4 UTSW 11 53400267 nonsense probably null
R8695:Aff4 UTSW 11 53368682 missense probably damaging 1.00
R8777:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8798:Aff4 UTSW 11 53400508 critical splice donor site probably benign
R8838:Aff4 UTSW 11 53406638 missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53372404 missense probably benign
R9146:Aff4 UTSW 11 53408136 missense probably benign 0.06
R9329:Aff4 UTSW 11 53397859 missense probably damaging 1.00
R9378:Aff4 UTSW 11 53372479 missense probably damaging 0.98
R9471:Aff4 UTSW 11 53380646 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GTGCTTTATTAATATCCACTGGCTC -3'
(R):5'- AACTCTCAGTCAAAGATGCTCTC -3'

Sequencing Primer
(F):5'- ATCCACTGGCTCAGTATGCATAG -3'
(R):5'- CTCAGTCAAAGATGCTCTCAATTC -3'
Posted On 2021-04-30